mirDIP : microRNA Data Integration Portal


Tissue: Search for microRNAs in different tissues in Homo sapiens.
(Binary results.)


miRNAs
   
or
Sequences
   


Search :
- You may enter a list of MicroRNAs (in the format hsa-miR-xxx, case sensitive) delimited by: spaces, tabs, commas or semicolons.

Results download :
- Do not use IE to download search results. Use either Chrome or Firefox browser.

Example search :
- MicroRNA symbols : hsa-miR-618, hsa-miR-95-3p, hsa-miR-4760-3p, hsa-miR-328-3p, hsa-miR-6890-3p, hsa-miR-4305, hsa-miR-4755-5p, hsa-miR-99a-3p, hsa-miR-1234-5p
- Sequence symbols : UGUAAACAUCCCCGACUGGA, UGUCCUCUGUUCCUCAG, UUCAAGUAAUUCAGGUG, UUCAGCAGGAACAGCU, GGGGGCAGGAACCCCCC

Note :
- All detected isomirs are shown for each microRNA




Search Options

Type   
Tissue   
Source
All datasets that are preprocced by our standardized pipeline are
indicated by *
Use 'Ctrl' (Windows) / 'Command' (Mac) for multiple selections.


 
Large input may take 2-3 minutes to complete. Please wait.





All contents copyright: Jurisica Lab, Schroeder Arthritis Institute, Krembil Research Institute - the University Health Network, Toronto, Canada. Last modified Jan 26, 2024. (Version 5.3.0.2, Database version 5.2.3.1)

All downloads and use of this database are subject to the following terms.

Permission to use, copy, and modify this database hereby granted to all academic and not-for-profit institutions without fee, provided that name of organization and author appear in all copies of the database. Under these conditions, the permission to modify and distribute or to make extended versions of the database is explicitly granted to non-profit organizations. All commercial entities willing to download or use the database must contact the authors. This database is provided "AS-IS" and with out any warranty of any kind. In no event shall Krembil Research Institute - the University Health Network or the authors be liable for any consequential damage of any kind, or any damages resulting from the use of this database.

Reference:
- Tokar T, Pastrello C, Rossos AEM, Abovsky M, Hauschild AC, Tsay M, Lu R, Jurisica I. mirDIP 4.1-integrative database of human microRNA target predictions. Nucleic Acids Res. 2018 Jan 4;46(D1):D360-D370. doi: 10.1093/nar/gkx1144. PubMed PMID: 29194489; PubMed Central PMCID: PMC5753284
- Shirdel EA, Xie W, Mak TW, Jurisica I, 2011 NAViGaTing the Micronome. Using Multiple MicroRNA Prediction Databases to Identify Signalling Pathway-Associated MicroRNAs. PLoS ONE 6(2): e17429. doi:10.1371/journal.pone.0017429