Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.71026148 |
When the cloned rabbit liver GH receptor is expressed in human kidney 293 cells , it migrates with a mol wt appropriate for the tyrosine kinase associated GH receptor , despite the calculated mol wt of the cloned GH receptor being 60 , 000 smaller than that of the tyrosine kinase associated GH receptor . 0.71026148^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.67288966 |
A novel complementary DNA ( cDNA ) encoding the chicken GH receptor was isolated from a chicken liver cDNA library , using polymerase chain reaction with primers derived from highly conserved sequences of the mammalian GH receptor . 0.67288966^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.58327793 |
Chicken GH did not form any complex with the purified hGH binding protein ( hGHBP ) , did not bind to human lymphocytes GH receptor , and did not affect Nb 2 cell proliferation . 0.58327793^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.79719661 |
The modified growth hormone ( GH ) was shown to bind to the GH receptor of IM 9 human lymphoid cells with an affinity of 0 . 55 10 10 ( 9 ) M 1 . 0.79719661^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.57684278 |
GH exerts its effect by interacting with its specific GH receptor ( GHR ) . 0.57684278^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.50494267 |
Although receptor binding studies failed to show any difference in binding characteristics , molecular modeling studies suggested that the Ile179Met substitution might nevertheless perturb interactions between GH and the GH receptor loop containing the hotspot residue Trp 169 , thereby affecting signal transduction . 0.50494267^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.57285233 |
GH interacts with the GH receptor ( GHR ) , a cytokine superfamily receptor , to activate the cytoplasmic tyrosine kinase , Janus kinase 2 ( JAK 2 ) , and initiate intracellular signaling cascades . 0.57285233^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.57163629 |
During cloning of GH receptor cDNA from salmon , we found a variant with relatively high ( 38 58 % ) sequence identity to vertebrate GH receptors and low ( 28 33 % ) identity to PRL receptors ; however , the recombinant protein encoding the extracellular domain showed only weak binding of GH . 0.57163629^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.78349751 |
Molecular cloning of a teleost growth hormone receptor and its functional interaction with human growth hormone . 0.78349751^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.61755657 |
Scatchard analyses of 125I labelled human GH binding to the serum GHBP were carried out with correction made for endogenous human GH which was measured by radioimmunoassay of each serum sample . 0.61755657^^^ A panel of monoclonal antibodies ( MAbs ) reactive with distinct epitopes on the rabbit liver GH receptor and rabbit serum GH binding protein ( GHBP ) were tested for cross reactivity with the GHBP from human serum . 0.51811556^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.51511515 |
Two forms exist for the GH receptor : the membrane bound form is a protein of 620 amino acid residues with a unique transmembrane domain ; the GH binding protein ( GHBP ) , which is a soluble short form , is identical to the extracellular domain of the membrane receptor . 0.51511515^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.53819001 |
Specific GHBP complexes of 158 and 85 kDa were detected , suggesting that the partially purified GHBP complex may be composed of a smaller GHBP associated noncovalently with a non GH binding protein . `` Pore limit ' ' native PAGE ( cathodic and anodic ) revealed the presence of specific GHBPs of 363 , 158 , 74 , and 55 kDa , which cross hybridized with the rat liver membrane GHR monoclonal antibody mAb 263 but not with the rat serum GHBP specific mAb 4 . 3 . 0.53819001^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.53604521 |
GH circulates in the plasma partially bound with a GH binding protein ( GHBP ) , but the physiological significance of the GHBP and how it affects GH bioactivity in vivo is still unknown . 0.53604521^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.70674366 |
Discussion : As the previous report of the relationship between GH binding reserve to GHBP and IGF 1 or BMI in non diabetic subjects , fGHBP again showed statistical links with these parameters in IDDM . 0.70674366^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.88201779 |
In addition to the possible in vivo significance of GHBP , the interaction between GH and GHBP has methodological implications for both GH and GHBP assays . 0.88201779^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.63388875 |
These results provide strong evidence that GH actually increases tyrosine kinase activity associated with the GHR . 0.63388875^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.51303243 |
Therefore , the GH dependent interaction of a particular STAT 5 with tyrosine phosphorylated GHR may play an important role in GH mediated signal transduction . . 0.51303243^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.79890452 |
We show here that GH can stimulate cellular oxygen consumption in CHO cells transfected with cDNA coding for the full length GHR . 0.79890452^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Conditions of affinity chromatography have been optimized , and further purification of the GH receptor by preparative isoelectric focusing and Sepharose 6B gel filtration resulted in a more than 8000 fold purification of the receptor . ^^^ The GH receptor was shown to be a sialoglycoprotein ( or closely associated with sialoglycoprotein ) by analytical isoelectric focusing with an isoelectric point of 4 . 6 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH receptor may consist of more than one molecular species , differing only in the carbohydrate type or content . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Studies on the molecular architecture and the composition of the GH receptor from rabbit liver . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The low GH BP activity may reflect the GH receptor status , indicating that GH receptors are poorly expressed in early infancy . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Interestingly , the high affinity GH binding protein ( GHBP ) is identical with the extracellular domain of GH receptor and is absent in patients with Laron type dwarfism , suggesting that serum GHBP might serve as a marker for the GH receptor in tissue . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The decrease in GH BP may render the acromegalic serum GH relatively more active in the GH receptor assay . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Similar assays were used to measure the levels of IGF 1 receptor mRNA and GH receptor mRNA , while the IGF 1 concentration in wound fluid and serum was determined by radioimmunoassay ( RIA ) after acid ethanol extraction . ^^^ There was no significant effect of GH on IGF 1 receptor mRNA and GH receptor mRNA levels . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have previously demonstrated that growth hormone ( GH ) promotes an increase in tyrosine kinase activity associated with the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The cDNA was cloned and found to have complete sequence homology to the extracellular domain of human liver GH receptor ( GH R ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We argued that if GH itself acts directly on the brain to govern its own secretion , then regions of the brain containing SS and GHRH neurons may express the GH receptor gene . ^^^ We tested this hypothesis by performing in situ hybridization for GH receptor messenger RNA ( mRNA ) and mapping its distribution in the brain . ^^^ We observed GH receptor mRNA containing cells in various brain regions including the thalamus , septal region , hippocampus , dentate gyrus , amygdala , and hypothalamus . ^^^ Next we sought evidence for expression of the GH receptor mRNA by SS neurons in the hypothalamus . ^^^ We addressed this by performing a double label in situ hybridization to identify neurons expressing both SS mRNA and GH receptor mRNA . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
SRIF binding and GH receptor mRNA are demonstrated on a subpopulation of GRH containing neurons in the hypothalamic arcuate nucleus . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In addition to the well documented presence of prolactin receptors in prostatic tissues , we have further demonstrated , by means of nuclease S 1 protection assays plus dot and Northern blot analyses , that a GH receptor mRNA is produced in the immature rat prostate . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Laron type dwarfism ( LTD ) is caused by a variable defect in the GH receptor gene and is , therefore , an ideal model to study the physiology of the insulin like growth factors ( IGFs ) and their binding proteins ( IGFBPs ) in the complete absence of GH action . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Evidence for the expression of the GH receptor ( GHR ) gene was obtained by northern blot analysis . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Recently , an isolated population of apparent GH receptor deficient ( GHRD ) patients has been identified in the Loja province of southern Ecuador . ^^^ These individuals presented many of the physical and biochemical phenotypes characteristic of Laron Syndrome and are believed to have a defect in the GH receptor gene . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This suggests peripheral GH unresponsiveness , similar to protein calorie malnutrition or GH receptor deficiency dwarfism , but mediated at a level distal to the hepatic GH receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
CONCLUSIONS : The finding that serum IGFBP 3 is low in Laron type dwarfism , a disease due to molecular defects in the GH receptor , is compatible with the hypothesis that this IGF binding protein is GH dependent . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Animals treated with bGH had reduced ( P less than 0 . 05 ) hepatic GH receptor mRNA compared to saline controls , but oPL treatment had no effect . ^^^ Our data suggest differences in receptor binding and effects on GH receptor and IGF binding protein 3 expression with these two treatments , raising the possibility of actions through different pathways or differential effects at the GH receptor level . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In the rat a GH binding protein ( GHBP ) exists that is derived from the GH receptor gene by an alternative messenger RNA splicing mechanism such that the transmembrane and intracellular domains of the GH receptor are replaced by a hydrophilic carboxy terminus . ^^^ Previous immunohistochemical studies detailing the localization of the GH receptor binding protein ( BP ) have used monoclonal antibodies that recognize extracellular region specific epitopes common to both the GH receptor and GHBP . ^^^ In this study we have used a monoclonal antibody ( MAb 4 . 3 ) specific for the carboxy terminus of the rat GHBP to map its somatic distribution in the rat and have compared this distribution with that of a MAb recognizing both the BP and the GH receptor . ^^^ The distribution of GHBP immunoreactivity ( MAb 4 . 3 ) was widespread and identical to that previously reported for the extracellular region of the GH receptor ( MAbs 263 and 43 ) . ^^^ GHBP immunoreactivity was predominantly associated with epithelial / endothelial cell subtypes and with mesenchymal elements such as muscle , chondrocytes , and osteoblasts , as previously described for the GH receptor extracellular region . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A much smaller number of hepatic cGH receptors was also found in dwarf hens , whereas the affinity of the hepatic GH receptor was not influenced by the genotype . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Differential regulation by growth hormone ( GH ) of insulin like growth factor 1 and GH receptor / binding protein gene expression in rat liver . ^^^ We now report the effects of hypophysectomy , T 4 and cortisone replacement , and the aforementioned continuous vs . intermittent GH treatment on liver IGF 1 and GH receptor ( GHR ) / binding protein ( GHBP ) gene expression in female rats . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To learn the mechanism of low plasma insulin like growth factor 1 ( IGF 1 ) despite high growth hormone ( GH ) secretion in patients with anorexia nervosa , we assessed human serum GH binding protein ( BP ) ( GH BP ) , which has been shown to be identical to the extracellular domain of GH receptor , and therefore might reflect peripheral GH receptor expression ( i . e . there is a significant linear correlation between GH BP and IGF 1 at less than 2 . 0 U / ml in healthy children ) . ^^^ The serum GH BP level was determined by gel filtration and confirmed by immunoassay using GH receptor monoclonal antibody . ^^^ Measurement of GH BP by the two assays gave identical results , suggesting that serum GH BP corresponds to the extracellular domain of GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Fetuses of 14 16 weeks gestation were obtained after therapeutic abortion , tissues were fixed , and immunocytochemistry was performed using monoclonal antibodies against purified rat or rabbit GH receptor . ^^^ GH receptor was also detectable as early as 8 weeks gestation in syncytial layers of the placenta and was maintained until term . ^^^ Results demonstrate the presence of immunoreactive GH receptor / binding protein in some human fetal tissues early in development . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The ability of the cloned liver growth hormone ( GH ) receptor , when expressed in mammalian cell lines , to copurify with tyrosine kinase activity and be tyrosyl phosphorylated was examined . 125I human growth hormone GH receptor complexes isolated from COS 7 cells transiently expressing high levels of the cloned liver GH receptor bound to anti phosphotyrosine antibody , suggesting that the cloned GH receptor is tyrosyl phosphorylated in vivo . ^^^ GH GH receptor complexes purified from transfected COS 7 cells using anti GH antibody incorporated 32P when incubated with [ gamma 32P ] ATP , indicating association of tyrosine kinase activity with cloned liver GH receptor . ^^^ The level of phosphorylation of the GH receptor was very low , as compared with the endogenous GH receptor in 3T3 F442A cells , suggesting that tyrosine kinase activity is not intrinsic to the cloned GH receptor but rather resides with a kinase present at low levels in the COS 7 cells . ^^^ To test whether a higher level of GH receptor phosphorylation would be observed when the GH receptor was expressed in a different cell line , GH receptor cDNAs were stably transfected into mouse L and CHO cells , which have few or no endogenous GH receptors , and RIN 5 AH cells , which do express endogenous GH receptors . ^^^ In vivo tyrosyl phosphorylation of the cloned GH receptor in mouse L cells and in vitro phosphorylation of the cloned GH receptor in both L and CHO cells were higher than in transfected COS 7 cells but still substantially lower than in untransfected 3T3 F442A cells . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We studied the relationship of serum insulin like growth factor 1 ( IGF 1 ) , IGF 2 , the IGF binding proteins IGFBP 1 , IGFBP 2 , and IGFBP 3 , and GH binding protein ( GHBP ; which is postulated to be derived from the extracellular portion of the GH receptor ) in normal volunteers and patients with anorexia nervosa before and after a refeeding program . ^^^ These data are consistent with the hypothesis that nutritional deprivation alters the GH IGF axis by down regulation of the GH receptor or its postreceptor mechanisms , and that this effect is reversible with refeeding . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) induction of tyrosine phosphorylation and activation of mitogen activated protein kinases in cells transfected with rat GH receptor cDNA . ^^^ The mechanism of growth hormone ( GH ) action was studied in Chinese hamster ovary ( CHO ) cells transfected with GH receptor cDNA . ^^^ Cytosolic extracts from GH or phorbol ester ( 12 O tetradecanoyl 4 beta phorbol 13 acetate ) treated cells , transfected with full length GH receptor cDNA , had an enhanced ability to phosphorylate myelin basic protein . ^^^ No GH effects were seen in untransfected cells , in CHO cells expressing a truncated GH receptor containing only 5 of 349 amino acids in the intracellular domain , or in cells expressing the soluble GH binding protein . ^^^ Growth hormone ( GH ) induction of tyrosine phosphorylation and activation of mitogen activated protein kinases in cells transfected with rat GH receptor cDNA . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Animal sera were characterized on the basis of human ( h ) GH and bovine ( b ) PRL binding levels , binding specificity toward GHs and PRLs , binding affinity constant ( Ka ) , and the ability of a monoclonal antirabbit GH receptor antibody ( MAb 7 ) to inhibit the binding to serum . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor activity reported by other researchers and GHBP activity in this study seem to vary similarly except during fasting , which may indicate alternate regulation of either the GHBP or the GH receptor . . ^^^ Growth hormone receptor activity reported by other researchers and GHBP activity in this study seem to vary similarly except during fasting , which may indicate alternate regulation of either the GHBP or the GH receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The recently described serum GH binding protein ( GH BP ) may reflect the GH receptor level . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In cultured fibroblasts capping of surface GH receptor was observed after aqueous formaldehyde fixation , whereas fixation in Carnoy ' s solution resulted in granular cytoplasmic staining . ^^^ We have demonstrated the presence of GH receptor protein in human skin and growth hormone receptor mRNA and protein in cultured human skin fibroblasts . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The regulation of hepatic GH receptor ( GHR ) and serum GH binding protein ( GHBP ) during pregnancy in the mouse was investigated by manipulating the number of conceptuses carried by the dam . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In order to elucidate potential sites of direct GH action on the kidney , we used in situ hybridization to localize GH receptor ( GHR ) gene expression during the course of development and in the adult rat . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Two mRNA transcripts that are believed to be alternately spliced products of the GH receptor gene have been reported in a variety of rat tissues . ^^^ An assay that is specific for the short isoform of the GH receptor , often referred to as the GHBP , has been developed using a rabbit antiserum that recognizes the unique amino acid sequence at its carboxyl end . ^^^ We conclude that 1 ) adipocytes synthesize the short isoform of the GH receptor , and that this protein is primarily associated with a membrane fraction of the cells ; and 2 ) the GHBP expressed in adipocytes is not released into the incubation medium and differs in size from the GHBPs in rat plasma . ( ABSTRACT TRUNCATED AT 400 WORDS ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The mechanism by which adequate growth is maintained in the presence of low GH levels is unknown , but is possibly mediated at the GH receptor level . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Residues within the first disulphide loop of the GH receptor are highly conserved , and the two cysteines forming this motif are conserved across many cytokine receptors . ^^^ We have used site directed mutagenesis and the polymerase chain reaction with splicing by overlap extension to show that these residues are essential for binding of bovine ( b ) GH and human ( h ) GH to the rabbit GH receptor . ^^^ Examination of the affinities of poly Ala , R39D and E42K mutants for a variety of hormone binding site directed and other monoclonal antibodies ( MAbs ) to the GH receptor revealed that these mutations were without a major effect on tertiary structure . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
There are GH binding proteins ( GHBPs ) present in the blood of many species , and these correspond to the extracellular GH binding domain of the GH receptor . ^^^ In the rat , GHBP arises by alternative splicing of the GH receptor mRNA , but little is known of the physiological role of circulating GHBP , or its relationship with episodic GH secretion . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Although GH has no direct effect on GH release from chicken pituitary glands , GH receptor mRNA similar to that in the rabbit liver was identified by Northern blot analysis in extracts of adult chicken pituitaries . ^^^ Complementary ( c ) DNA , reverse transcribed from chicken pituitary RNA , was amplified by the polymerase chain reaction ( PCR ) in the presence of 3 ' and 5 ' oligonucleotide primers coding for the extracellular domain of the chicken liver GH receptor and was found to contain an electrophoretically separable fragment of 500 bp , identical in size to that in chicken liver . ^^^ Amplification of chicken pituitary cDNA in the presence of oligonucleotide primers for the intracellular sequence of the chicken liver GH receptor produced an electrophoretically separable fragment of approximately 800 bp , similar to that in chicken liver . ^^^ Translation of the GH receptor mRNA in the pituitary gland was indicated by the qualitative demonstration of radiolabelled GH binding sites in plasma membrane preparations , in pituitary cytosol and in nuclear membranes . ^^^ These results provide evidence for the expression and translation of the GH receptor gene in pituitary tissue , in which GH receptors appear to be widely distributed within cells and in different cell types . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The decreased concentration of GH BP may indicate decreased expression of the GH receptor in target tissues , and hence diminished responsiveness to GH in renal failure . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GHBP represents the extracellular binding domain of the GH receptor and modulates the action of GH . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In the present study , we have transfected Chinese hamster ovary ( CHO K 1 ) cells with a cDNA clone encoding a full length transmembrane ovine ( o ) GH receptor , under the regulatory control of the human metallothionein IIA promoter . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
So far , it has not been possible to define a specific molecular defect in one of these patients . ( 2 ) Abnormalities of the GH receptor or postreceptor mechanisms lead to a GH insensitivity syndrome . ^^^ In three additional populations , the Pygmies of Zaire , the little women of Loja in Ecuador and the Mountain Ok people in Papua New Guinea , alterations of GH receptor function have been described . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The lack of a stimulatory effect of GH injection in 3 day old fed chicks might be the combined result of a low hepatic type 3 enzyme level and a low GH receptor availability at that stage . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
There are indications that the expression of the GH receptor gene itself is dependent on the sexually differentiated pattern of GH secretion . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH receptor has been reported to be phosphorylated on tyrosine in 3T3 F442A cells , a cell line in which GH promotes differentiation and inhibits mitogen stimulated growth ; however , it is not known whether tyrosine phosphorylation plays a role in GH signal transduction . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These observations suggest that serum GH BP levels reflect major changes of hepatic GH receptor status . ( ABSTRACT TRUNCATED AT 250 WORDS ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The lack of requirement for GH in GH independent and nondifferentiating cells compared to 3T3 F442A cells does not appear to reflect the lack of GH receptors , since expression of mRNA for the GH receptor was evident in all of the cell types tested and , thus , corresponds with the ability of GH to induce protooncogene expression . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Furthermore , the relationship between expression of the GH receptor ( GHR ) and its soluble truncated form ( GH binding protein , GHBP ) is unclear . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Previous studies in our laboratory have identified a portion of big big GH as actually being anti GH receptor immunoglobulins . ^^^ We now report the isolation of two types of anti GH receptor antibodies from the serum of active acromegalic patients . ^^^ The main aim of the present study was to explore whether these anti GH receptor IgGs possess GH like biological activity . ^^^ The results suggest that biologically active anti GH receptor antibodies may contribute in the pathology of some cases of acromegaly . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The major GHBP ( high affinity GHBP ) is homologous to the extracellular portion of the GH receptor and the concentration of this protein in circulation may reflect the status of the GH receptor in the tissues . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The diagnosis was confirmed by our method in 13 patients with Laron type dwarfism and in four patients the GH receptor defect had been proved . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The mechanism of GH resistance is unknown ; it may involve a defect at the level of the GH receptor , unresponsiveness due to a postreceptor defect in GH action , or both . ^^^ To investigate a potential receptor involvement , we measured plasma high affinity GH binding protein ( GHBP ) , which represents a truncated GH receptor and may reflect GH receptor levels in tissues , in patients with IDDM , patients with non insulin dependent diabetes ( NIDDM ) , and nondiabetic control subjects . ^^^ We conclude that IDDM is associated with low GHBP levels and that GH resistance found in this disorder may be mediated , at least in part , by a decrease in GH receptor levels . ( ABSTRACT TRUNCATED AT 250 WORDS ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In attempting to define the role of these hormones in placental development , we have structurally characterized the human placental GH receptor ( GHR ) mRNA . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH binding proteins appear to be produced by post translational modification of a single GH receptor transcript rather than alternative splicing of a primary transcript since only one GH receptor mRNA transcript ( 4 . 2 kb ) was detected on Northern analysis . ^^^ Our findings indicate that : 1 ) bGH is the preferred ligand to use to study GH binding in pig adipose tissue membranes ( or adipocytes ) ; 2 ) exogenous pGH does not alter GH binding ; and 3 ) only one GH receptor mRNA transcript is present in pig adipose tissue . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Liver GH receptor ( GHR ) like mRNA has been shown to be widely distributed throughout rat and rabbit pituitary glands . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The basis for this discrepancy may lay in the competitive power of GH BP toward GH receptor binding . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The refractoriness of guinea pigs to the growth promoting actions of exogenous GH has been suggested to be due to a deficiency or defect in tissue GH receptors or in GH receptor gene expression . ^^^ GH receptor mRNA was , however , demonstrated by Northern blot analysis and by the polymerase chain reaction in extracts of guinea pig liver , adipose tissue , brain , hypothalamus and pituitary gland . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Although fetal growth is generally considered to be independent of pituitary growth hormone ( GH ) , it is possible that pituitary GH plays a modulatory role in organ development or that a GH like substance of non pituitary origin may influence fetal growth through the GH receptor . ^^^ Accordingly , we have used immunohistochemistry , northern blot analysis , the reverse transcriptase polymerase chain reaction and solution hybridization to study the ontogeny of the GH receptor / binding protein ( BP ) from the 12 day old embryo ( E 12 ) to the E 18 rat fetus . ^^^ GH receptor / BP immunoreactivity was observed in all major organ systems of the E 18 rat fetus and was not preferentially associated with any germ layer derivative . ^^^ A general increase in GH receptor / BP immunoreactivity was evident from E 12 to E 18 , with a marked increase occurring between E 16 and E 18 . ^^^ Most noteworthy of the other tissues expressing GH receptor / BP immunoreactivity by day 18 were skeletal and smooth muscle , chondroprogenitor cells , epithelial lining cells , neuronal ganglia , ependymal cells and the adrenal cortex . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The hepatic GH receptor ( GHR ) encoding message increased 8 fold between nonpregnant and pregnant mice . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A series of indirect pieces of evidence suggest that the measurement of circulating GH BP may enable an evaluation of the GH receptor . ^^^ On the other hand GH BP competes with the GH receptor for GH binding and , thus , diminishes the biological effect of GH . ^^^ We suggest a biological role for GH BP as follows : an increase in the availability of GH results not only in the upregulation of the GH receptor but also in increased turnover of this receptor , its internalization and recycling . ^^^ The extracellular domain of the GH receptor is homologous , to a large extent , with the sequence of several receptors for hormones and cytokines , which have recently been cloned . ( ABSTRACT TRUNCATED AT 250 WORDS ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
However , the membrane bound form of the adipose receptor was 1000 fold less reactive with one binding site directed MAb ( MAb 7 ) than the membrane bound liver GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Addition of a monoclonal antibody to the GH receptor ( MAb 263 ) did not result in a stimulation or inhibition of 3H AIB uptake or stimulation of protein synthesis in reserpinized rat hemidiaphragms . ^^^ Our results also imply that the type 1 GH receptor of Barnard , Bundesen , Rylatt and Waters ( 1985 ) does not mediate the insulin like actions of GH on rat diaphragm . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To investigate this possibility GH receptor mRNA was measured in cultured rat epiphyseal chondrocytes in the absence or presence of GH under various experimental conditions . ^^^ GH receptor mRNA was measured with a solution hybridization technique using [ 35S ] UTP labeled RNA growth hormone receptor cloned from rat liver cDNA . ^^^ Human GH ( hGH ; 50 ng / ml ) increased GH receptor mRNA after 3 h and maximal levels were seen 12 h after GH addition . ^^^ The hGH stimulated increase of GH receptor mRNA was completely blocked by actinomycin C 1 ( 1 . 0 0 . 1 micrograms / ml ) , while cycloheximide ( 10 micrograms / ml ) only slightly counteracted the hGH effect . ^^^ A high dose of insulin like growth factor 1 ( IGF 1 ; 1 microgram / ml ) caused a small stimulatory effect and addition of 10 % calf serum caused a marked increase in GH receptor mRNA . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The serum concentrations of a specific GH binding protein , derived from the GH receptor , were assayed in sera from 62 African pygmies and 101 normal statured controls . ^^^ This is most compatible with a change in regulating expression of the GH receptor gene , rather than a structural defect in the coding sequence of the GH receptor gene . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The levels of GH receptor ( GH R ) and PRL receptor ( PRL R ) determined by competitive binding assays were similar to those observed in late pregnant , nontransgenic mice . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression and regulation of growth hormone ( GH ) receptor messenger ribonucleic acid ( mRNA ) in rat adipose tissue , adipocytes , and adipocyte precursor cells : GH regulation of GH receptor mRNA . ^^^ The effects of hypophysectomy and hormonal replacement therapy on GH receptor ( GH R ) gene expression was studied in rat adipose tissue with a cRNA probe corresponding to the amino terminal of the hepatic GH R . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To examine whether this effect is prerequisite to human folliculogenesis , a patient with Laron type dwarfism ( IGF 1 deficiency secondary to GH receptor abnormality ) was examined while undergoing in vitro fertilization treatment . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We presented a 16 year old boy with severe growth retardation and markedly decreased levels of growth hormone binding protein ( GHBP ) in plasma , which was shown to correspond to the extracellular composition of hepatic GH receptor and suggested to reflect tissue concentration of the receptor . ^^^ GHBP activities were definitely low by gel filtration , immunoprecipitation and charcoal methods , as seen in Laron dwarfism which is defined as a syndrome of congenital GH receptor defects . ^^^ These results indicate that the tissue content of GH receptor in this case was quantitatively reduced and as a result , he showed a resistance to endogenous and exogenous GH . ^^^ It remains to be elucidated whether the GH receptor defect in our case is derived from a genetic origin or an acquired condition . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of GH receptor mRNA in regenerating skeletal muscle of normal and hypophysectomized rats . ^^^ A digoxigenin labelled RNA probe directed against the extracellular part of the rat GH receptor was used . ^^^ In both normal and hypophysectomized rats distinct expression of GH receptor mRNA could be demonstrated in the regenerating muscle cells at the myoblast / myotube stage . ^^^ The GH receptor expression appeared to decline with increasing maturation of the regenerated muscle fibres . ^^^ In hypophysectomized rats , the regeneration process and the expression of GH receptor mRNA was delayed compared with that in normal animals . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Accelerated pubertal growth in both males and females depends upon the integrity of the GH receptor system . ^^^ In males , acceleration of growth results primarily from enhanced sensitivity of the GH receptor IGF 1 system to GH brought about by testosterone . ^^^ Though the pygmy data certainly supports a relationship between testosterone and the GH receptor IGF 1 axis , the undisputed tall stature of eunuchs remains a puzzle . ^^^ At any rate , acceleration of growth in males results from sensitization or the GH receptor IGF 1 system while growth acceleration in females results almost solely from increased secretion of GH and not sensitization of the system . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Young and old rats were used to examine the influence of age on the expression of IGF 1 and GH receptor mRNAs in the liver . ^^^ Levels of both IGF 1 mRNA and GH receptor mRNA were found to decrease with age ( 2 . 8 fold and 1 . 7 fold respectively ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In human serum , a specific binding protein with high affinity for human growth hormone ( GHBP ) is found which is identical to the extracellular portion of the hepatic GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
After secretion , GH binds to two ( or possibly more ) circulating GH binding proteins , one of which is a truncated GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The molecular structure of the GH receptor has recently been characterized and the receptor identified as a member of a new receptor superfamily that includes the prolactin receptor and several cytokine receptors . ^^^ Whether such a mechanism is involved in signal transduction of the GH receptor is not known . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Cloning of the rabbit and human liver GH receptor has shown that the receptor is a single polypeptide chain of 620 amino acids , made of an extracellular hormone binding domain , with 7 cysteines and 5 potential glycosylation sites , a unique transmembrane domain and a long cytoplasmic domain . ^^^ The GH receptor belongs to a new family including prolactin and cytokine receptors . ^^^ The GH binding protein ( GH BP ) , identified in plasma of man and other species , corresponds to the extracellular binding domain of the membrane GH receptor . ^^^ Evaluation of the GH BP is a direct approach to the GH receptor in man in vivo . ^^^ Complete absence of GH binding activity has been found in the plasma of patients with Laron dwarfism , in particular those for whom a mutation in the GH receptor gene has been demonstrated . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
States of GH resistance , such as chronic renal failure , and certain idiopathic short statures , are associated with low levels of GH binding protein ; in Laron type dwarfism a defect of the GH receptor gene probably results in the absence of plasma GH binding activity . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The major binding protein is a truncated , variant form of the target tissue GH receptor and is synthesized by all tissues expressing the full length GH receptor . ^^^ The GH receptor and GH binding protein are not co ordinately expressed , being produced in variable ratios between tissues . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This condition appears to be similar to Laron dwarfism in humans , in which the low IGF 1 is caused by an abnormality in the GH receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Previous studies have described the close similarity of the GH binding protein to the liver membrane GH receptor . ^^^ We suggest that the short term pharmacodynamic changes probably represent the endogenous turnover of the GH receptor , whereas the elevated GH binding protein activity on hGH treatment may reflect up regulation of the GH receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Northern analysis indicates the presence of at least 2 alternately spliced mRNA transcripts for the GH receptor , and at least 3 different complexes are seen after GH is covalently crosslinked to intact adipocytes . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Liver GH receptor levels were up regulated in DTM or wild type bGH transgenic mice . ^^^ The decrease in serum IGF 1 resulting from the interaction between the bGH analog , the endogenous mouse GH , and GH receptor ( s ) apparently leads to a dwarf phenotype . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The distribution of GH receptor ( GHR ) and GH binding protein ( GHBP ) mRNAs in multiple rat tissues was examined by Northern blotting using a cDNA fragment encoding the common extracellular domain of the GHR and the serum GHBP . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A comparison was made between these GHBPs and the hepatic GH receptor ( e . g . molecular weight estimates , affinity for homologous versus heterologous GHs , cross reactivity with prolactin , presence of N linked carbohydrate ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The recently characterized GH binding protein ( GH BP ) has an amino acid sequence identical to the extracellular domain of the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Using this functional system we analyzed the effect of COOH terminal truncation of the GH receptor . ^^^ We conclude that domains within the COOH terminal half of the cytoplasmic part of the GH receptor are required for transduction of the signal for GH stimulated insulin synthesis , whereas cytoplasmic domains proximal to the transmembrane region are involved in receptor mediated GH internalization . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Although the structure of several members of the GH receptor family has been defined , signal transduction following GH binding to its receptor has not been elucidated . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Liver GH binding protein and GH receptor mRNA abundance were reduced by 1 week of protein deprivation at week 6 but not at week 4 . ( ABSTRACT TRUNCATED AT 250 WORDS ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
It can be indirectly deduced that this reflects a similar relationship with the human GH receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
OBJECTIVE : Normal serum contains a high affinity GH binding protein , which appears to be identical with the extracellular domain of the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These results show that glucose counteracts decrease of GH binding sites during culture and suggest that it affects de novo synthesis of GH receptors , presumably through glycosylation of a certain protein that regulates GH receptor gene expression ( new protein synthesis ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Mutations in the GH receptor gene have been demonstrated in Laron type dwarfism . ^^^ Different exon deletions or point or nonsense mutations resulting in modifications in the extracellular , GH binding region of the GH receptor have been reported . ( ABSTRACT TRUNCATED AT 400 WORDS ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We report here that GH receptor immunoreactivity can be demonstrated in the nuclei of GH responsive rat and rabbit tissues at both the light and electron micrograph level using monoclonal antibodies to the receptor extracellular domain . ^^^ A panel of GH receptor monoclonal antibodies was used to further define these nuclear binding sites as being antigenically identical to microsomal receptor in all but one case . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In the rat the major growth hormone binding protein ( GH BP ) is a truncated , variant form of the target tissue GH receptor and is derived by an alternative mRNA splicing event . ^^^ The GHBP mRNA is coexpressed in all tissues expressing the full length GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Human serum contains a high affinity GH binding protein ( GHBP ) whose amino terminal sequence is identical to the extracellular domain of the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The mature GH receptor comprises an extracellular domain of 242 amino acids , a hydrophobic transmembrane region of 24 amino acids , and a cytoplasmic domain of 350 amino acids . ^^^ The onset of GH receptor mRNA expression in the liver is developmentally regulated : GH receptor transcripts are first detected by Northern blot hybridization in liver taken from a term ( 145 days of gestation ) fetus and reach maximum levels within one week following birth . ^^^ Ribonuclease protection assays reveal heterogeneity within the 5 ' untranslated region of GH receptor mRNA transcripts detected in liver and a number of other tissues . ^^^ At least one transcript appears to be expressed in a liver specific fashion , supporting a role for alternative RNA splicing in the tissue specific regulation of sheep GH receptor expression . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These results suggest that cell density modulates GH receptor induction by dexamethasone via events after glucocorticoid receptor binding . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Specific hybridization of polyadenylated RNA , extracted from rat , rabbit and human pituitary glands with a 638 bp rabbit GH receptor ( rGHR ) cRNA was demonstrated by Northern analysis . ^^^ Thus , although the GH receptor gene is expressed in pituitary tissue , functional GH receptors may not be inserted into pituitary plasma membranes . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The plasma GH binding protein ( GHBP ) , which has been recently isolated and identified as similar to the extracellular part of the liver cells receptor to GH , is lacking in two of the three patients and subnormal in their heterozygous parents , these data suggesting a defect of the GH receptor or of its extracellular part . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Two circulating GH binding proteins ( GH BP ) , one of which is related to the GH receptor , have been described . ^^^ Levels of the high affinity ( GH receptor related ) GH BP were significantly lower in the Mountain Ok subjects than in the taller controls ( 5 . 2 + / 3 . 0 % vs . 10 . 6 + / 3 . 9 % GH bound / 160 microL , respectively ; mean + / SD ; P less than 0 . 001 ) . ^^^ Because of the structural similarity between the GH receptor and GH BP , these data suggest that a limitation in GH receptor / GH BP endowment may be associated with short stature despite normal circulating IGF 1 levels . ^^^ Thus , the GH receptor ( and / or GH BP ) complement may be a determinant of the genetically programmed height achieved . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Effect of hypophysectomy and acute administration of growth hormone ( GH ) on GH receptor binding in chick liver membranes . ^^^ This effect was due to a rise in binding capacity rather than a change in binding affinity of the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The high affinity GH BP is related to the GH receptor and may modulate the interaction of GH with tissue receptors , whereas the low affinity GH BP should be inert in this regard . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH binding protein ( GHBP ) has been shown to contain the extracellular portion of the cell surface GH receptor ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) regulation of cytochrome P 450IIC12 , insulin like growth factor 1 ( IGF 1 ) , and GH receptor messenger RNA expression in primary rat hepatocytes : a hormonal interplay with insulin , IGF 1 , and thyroid hormone . ^^^ The GH receptor ( GHR ) , being the common denominator for the GH response , was also studied . ^^^ Growth hormone ( GH ) regulation of cytochrome P 450IIC12 , insulin like growth factor 1 ( IGF 1 ) , and GH receptor messenger RNA expression in primary rat hepatocytes : a hormonal interplay with insulin , IGF 1 , and thyroid hormone . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) stimulates protein synthesis in cells transfected with GH receptor complementary DNA . ^^^ An expression vector containing a rat GH receptor cDNA was transfected into Chinese hamster ovary ( CHO ) cells , and stable cell lines expressing GH receptors were established . ^^^ GH treatment stimulated protein synthesis 60 % over basal levels in GH receptor expressing CHO cells , but not in the receptor negative parental cells . ^^^ These results show that heterologous expression of the rat GH receptor results in the appearance of specific binding of GH and the acquisition of a functional GH response . . ^^^ Growth hormone ( GH ) stimulates protein synthesis in cells transfected with GH receptor complementary DNA . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The main plasma growth hormone binding protein ( GHBP ) , recently identified and considered as being identical to the extracellular part of the cell receptor to GH , was absent in two of the three patients , and lower than normal in their parents , suggesting a defect of the cell GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have used immunohistochemistry to localize GH receptor / binding protein ( BP ) in the male and female reproductive systems of adult rats . ^^^ Testes and ovaries from neonatal animals were also examined to determine if GH receptor / BP expression in these tissues is developmentally regulated . ^^^ Localization of the receptor / BP was observed in both the nucleus and cytoplasm of immunopositive cells confirming our recent report of a nuclear GH receptor . ^^^ Intense GH receptor / BP immunoreactivity in the male reproductive system was evident in the epithelium of the vas deferens and coagulating gland , the prostatic epithelium during the secretory phase , and the ductular epithelium of the coagulating and bulbourethral glands , respectively . ^^^ Intense GH receptor / BP immunoreactivity in the female reproductive system was evident in the germinal epithelium , the vascular endothelium of the myometrium , the epithelial lining of the fimbriae and oviduct , the endometrial epithelium and scattered endometrial glands , the mesothelium of the perimetrium , and the vascular endothelium of the endometrium . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The immediate consequences of GH receptor interaction as well as the mechanism of signal transduction leading to induction of the c fos gene remain , therefore , unresolved . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Both bovine GH and rat GH , which bind to the rat GH receptor but not to the PRL receptor , also stimulated DAG production . ^^^ Similarly , human PRL , which binds to the PRL but not GH receptor , stimulated DAG formation to a comparable extent . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Highly purified GH receptor preparations from 3T3 F442A fibroblasts , whose differentiation into adipocytes is promoted by GH , have been shown to contain a tyrosine kinase capable of phosphorylating GH receptors . ^^^ In the current work , characteristics of the tyrosine kinase responsible for the in vitro phosphorylation of GH receptors from cultured 3T3 F442A fibroblasts were examined , and the presence of this GH receptor associated tyrosine kinase activity was demonstrated in multiple cell types . ^^^ GH receptor complexes from GH treated cells were partially purified by immunoprecipitation using anti GH antibodies and then incubated as an immune complex with [ gamma 32P ] ATP . ^^^ Incorporation of 32P into the GH receptor from 3T3 F442A fibroblasts was apparent within 1 min at 30 C after the addition of [ gamma 32P ] ATP ( 5 10 microM ) . ^^^ Excess unlabeled ATP , but not cytosine triphosphate , GTP , or uridine triphosphate , abolished 32P incorporation into the GH receptor and [ gamma 32P ] GTP could not replace [ gamma 32P ] ATP as a source of 32P . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The human liver GH receptor has been further characterized using several biochemical approaches . ^^^ By immunoblot , using a polyclonal antibody raised against a synthetic peptide ( residues 391 405 of the mature human GH receptor ) , a single band of 100 k was detected . ^^^ Human liver GH receptor and plasma GH binding protein ( BP ) were purified 1 , 000 and 4 , 000 fold , respectively . ^^^ Polyclonal antibodies raised against the hepatic GH receptor inhibited the binding of hGH to the human receptor and were able to immunoprecipitate the GH receptor and also the GH BP complex . ^^^ Our findings demonstrate the existence of multiple forms of the GH receptor in human liver ( major components of 100 and 50 55 k , minor component of 130 k ) ; they lend more support to the possible subunit structure of the GH receptor ; and finally , they also suggest a close relationship , with common antigenic properties , of the membrane receptor and the plasma GH BP . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To determine whether the recently cloned rat hepatic GH receptor is able to mediate the insulinotropic effect of GH , we have transfected a GH receptor cDNA under the transcriptional control of the human metallothionein promoter into RIN 5 AH cells . ^^^ The transfected cells were found to exhibit an increased expression of GH receptors and to contain a specific GH receptor mRNA that was not expressed in the parent cell line . ^^^ The increased GH receptor expression was accompanied by an increased responsiveness to GH . ^^^ The increased expression of the GH receptor by Zn2+ was associated with an increased magnitude of GH stimulated insulin biosynthesis . ^^^ We conclude from these results that the hepatic GH receptor is able to mediate the effect of GH on insulin biosynthesis in RIN 5 AH cells . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptor messenger RNA ( mRNA ) was identified and characterized in mammary tissue from normal and GH treated lactating cows using Northern and in situ hybridization analyses . ^^^ One major GH receptor transcript of 4 . 4 kilobases and a less abundant transcript of 9 . 2 kilobases were detected in mammary tissue from both normal and GH treated cows . ^^^ In situ hybridization analysis revealed that the GH receptor gene is primarily expressed in the alveolar epithelial cells of mammary tissue . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH BP in these species is identical to the extracellular part of the GH receptor ( GH R ) with the transmembrane and intracellular domain substituted for a hydrophilic tail . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Immunohistochemistry was performed in the adult rat GIT with a panel of characterized monoclonal antibodies to the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The present study was undertaken to investigate the role of hypo and hyperthyroidism on the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
At term the contributions to total GH activity of serum are less than 3 % from the pituitary , 12 % from human chorionic somatomammotropin reacting with the GH receptor , and 85 % from placental GH . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Hypophysectomy eliminates and growth hormone ( GH ) maintains the midpregnancy elevation in GH receptor and serum binding protein in the mouse . [ 125I ] Iodomouse GH [ ( 125I ] iodo mGH ) binding to samples of serum and hepatic microsomal membranes was measured in hypophysectomized pregnant , sham operated pregnant , intact pregnant , and intact adult virgin mice . ^^^ No significant differences were observed between intact and sham operated pregnant animals in the maternal serum mGH concentration , the serum GH binding protein concentration , or the hepatic GH receptor concentration . ^^^ GH receptor and binding protein encoding mRNAs were also higher in intact and sham operated pregnant mice than in virgin and hypophysectomized mice . ^^^ Hypophysectomized mice were treated with 200 micrograms / day bovine GH , administered by osmotic minipump ; after 3 days of treatment , a significant elevation of hepatic GH receptor and serum GH binding protein levels was observed . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The identification of specific GH binding proteins ( GH BP ) in human plasma , one of which is a fragment of the GH receptor , has added new complexity to the state of GH in the circulation . ^^^ We conclude that in normal man plasma GH BP activity is constant throughout the day , thereby implying 1 ) constancy of binding protein ( and possibly GH receptor ) concentration , and 2 ) absence of significant fluctuations in potential binding inhibitors / enhancers in plasma . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
IgGs that bound to GH receptor sites in the absence and presence of 250 nM hGH ( for nonspecific binding ) were detected using anti hIgG ( Fc specific ) antibody conjugated with alkaline phosphatase . ^^^ The protein A purified IgGs from serum 4 bound specifically to GH receptor sites in adipocyte membranes and displaced [ 125I ] hGH in the hGH RIA . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To investigate its genetic basis , we used genetic linkage to test whether the disorder results from a defect in the gene for the human GH receptor . ^^^ Denaturing gradient gel electrophoresis and sequencing of specific GH receptor gene fragments allowed us to characterize specific intragenic DNA markers in 35 control subjects of Mediterranean descent , for use in linkage studies . ^^^ Moreover , an analysis of the GH receptor gene RNA transcripts in lymphocytes from one of these families allowed us to identify a thymidine to cytosine substitution that generated a serine in place of a phenylalanine at position 96 in the extracellular coding domain of the mature protein . ^^^ This mutation was not found in the GH receptor genomic sequences of seven unrelated subjects with Laron dwarfism who belonged to different population groups . ^^^ An analysis of the GH receptor markers in these patients indicated that different gene frameworks ( polymorphic sites within the single gene ) were associated with the mutant alleles . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Digestion of covalently linked [ 125I ] human ( h ) GH receptor complexes with neuraminidase or endoglycosidase F reduced the mass of the principal hormone receptor complex from about 130 kilodaltons ( kDa ) to 120 and 110 kDa , respectively , suggesting that about 20 % of the mass of the GH receptor of rat adipocytes consists of N linked sialocarbohydrates . ^^^ We conclude that 1 ) N linked carbohydrates contribute about 20 kDa to the apparent mass of the GH receptor of rat adipocytes ; 2 ) N linked glycosylation is not required for GH receptors to be inserted into the adipocyte membrane in the proper orientation and to retain their ability to recognize and bind GH ; 3 ) N linked sugar chains are required for maintenance of a normal high affinity of receptors for GH ; 4 ) N linked carbohydrates are necessary for normal rates of internalization and processing of bound hGH . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The interrelationship of growth hormone ( GH ) , liver membrane GH receptor , serum GH binding protein activity , and insulin like growth factor 1 in the male rat . ^^^ Indirect evidence suggests that the serum GH binding protein ( GH BP ) is related and possibly derived from the GH receptor . ^^^ In both the pulsation experiment and the continuous infusion experiment , GH BP closely correlated with the liver membrane GH receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Hepatic GH receptor mRNA also decreased in fasting rats . ^^^ This indicates that the GH receptor down regulation that occurs in fasting is accompanied by and probably at least partly caused by a decline in GH receptor mRNA . ^^^ The magnitude and kinetics of the decline in GH receptor mRNA were similar to the magnitude and kinetics of the decline in IGF 1 mRNA , suggesting that the two mRNAs may be regulated by a similar mechanism . ^^^ There was no significant change in the levels of liver beta actin or serum albumin mRNA under the same conditions , indicating that the regulation of IGF 1 and GH receptor mRNA was specific . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have used a monoclonal antibody recognizing the human GH receptor to visually identify and localize GH receptors in the human infant growth plate . ^^^ Sections of cultured chondrocytes were stained immunocytochemically with a monoclonal antibody recognizing human GH receptor ( MAb 263 ) , using an avidin biotin system . ^^^ In infant tissue , GH receptor was identified in sections in chondrocytes of the proliferative and hypertrophic layers , in perichondrium , in osteocytes in new bone , and in hemopoietic precursor cells in marrow . ^^^ Cultured chondrocytes showed heterogeneous staining for GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Two cDNA probes derived from the nucleic acid sequence for the rabbit GH receptor were used to study RNA samples from normal and hypophysectomized ( hypox ) rat tissues by Northern analysis . ^^^ Results obtained with a probe that contained a nucleotide sequence corresponding to part of the extracellular domain of the GH receptor indicated that rat liver , gastrocnemius muscle , and epididymal fat each contain a 4 . 4 kilobase ( kb ) message and one or more shorter messages that appear to be homologous to the rabbit GH receptor message . ^^^ The other probe , which contained a nucleotide sequence that corresponds to the intracellular domain of the GH receptor , detected only one 4 . 4 kb message in these rat tissues . ^^^ These results suggest that rat tissues may synthesize several forms of the GH receptor , but only one form that contains a region homologous to the intracellular domain of the rabbit liver GH receptor . ^^^ No significant difference was seen between GH receptor message levels of normal and hypox rat liver when the results were expressed as a fraction of the total RNA . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The availability of a simple and convenient procedure for large scale determination of GH BP coupled with the suggestion that this protein can reflect the GH receptor provides us with an indirect means for assessing changes in GH receptor activity in various physiological and pathological conditions . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We describe the use of four monoclonal antibodies ( MAbs ) to the rabbit liver growth hormone ( GH ) receptor and one raised against purified rat liver GH receptor to characterize liver receptor subtypes which differ in their hormone binding regions . ^^^ The anti ( rat liver GH receptor ) MAb both inhibited and precipitated rat and rabbit GH receptors , but only one half of 125I oGH ( ovine GH ) binding to liver microsomes could be inhibited by excess antibody . ^^^ Conversely , only one half of 125I anti ( rat GH receptor ) MAb binding was inhibited by excess oGH and Scatchard plots for this MAb exhibited two components . ^^^ We postulate two epitopes for the anti ( rat GH receptor ) MAb , one located at the hormone binding site ( inhibitory site ) and one elsewhere ( immunoprecipitating site ) . ^^^ A second , rabbit specific antibody ( MAb 7 ) inhibited 85 % of hormone binding but only 30 % of 125I anti ( rat GH receptor ) MAb binding to rabbit liver microsomes . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Two of the IgG subclass antibodies were able to inhibit the binding of [ 125I ] iodo oPL to PRL receptors ( s ) and to GH receptor ( s ) in rabbit mammary gland and liver , respectively . ^^^ One of these two IgG subclass antibodies was more effective at inhibiting the binding of oPL to PRL receptor ( s ) in rabbit mammary gland , whereas the other one is more effective in inhibiting the binding of oPL to GH receptor ( s ) in rabbit liver . ^^^ Our results suggest that oPL might contain two distinct binding sequence ( s ) : one responsible for the binding of oPL to PRL receptor ( s ) and the other responsible for the binding of oPL to GH receptor ( s ) . ^^^ The interaction of monoclonal antibodies with these binding sequences of oPL may block the binding of oPL with PRL and GH receptor ( s ) . ^^^ Alternatively , our studies suggest that the monoclonal antibodies do not bind to hormone receptor ( s ) binding sequence ( s ) in oPL , but the interaction between oPL and monoclonal antibody might alter the conformational structure of the oPL which will consequently lead to a lower binding of oPL to PRL and GH receptor ( s ) . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
As shown in receptor assay , all the 4 McAbs exhibited specific inhibition on the binding of pregnant rabbit liver GH receptor to 125I hGH . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In the present study , we investigated the possibility that a tyrosine kinase is specifically associated with the GH receptor . ^^^ GH receptor complexes were first partially purified from GH treated 3T3 F442A fibroblasts , a GH responsive cell , by immunoprecipitation using anti GH antiserum . 35S Labeled proteins of Mr = 105 , 000 125 , 000 were observed in the immunoprecipitate from GH treated cells labeled metabolically with 35S amino acids . ^^^ When partially purified GH receptor preparation was incubated with [ gamma 32P ] ATP ( 7 15 microM ) for 10 min at 30 degrees C in the presence of MnCl 2 , a protein of Mr = 121 , 000 was phosphorylated exclusively on tyrosyl residues . ^^^ As expected for the GH receptor , this protein was not observed in immunoprecipitates when cells had not been treated with GH nor when non immune serum replaced the anti GH antiserum . ^^^ GH receptor complexes were also purified to near homogeneity by sequential immunoprecipitation with phosphotyrosyl binding antibody followed by anti GH antiserum . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These results suggest that PGF has direct insulin like actions which are initiated by binding a GH receptor , but PGF had no anti insulin action and the insulin like activity of PGF was unaffected by refractoriness of adipose tissue to GH . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH receptor in adipocytes is a glycoprotein that has a half life of less than 1 h . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A smaller number of hepatic cGH receptors was found in dwarf hens , whereas the affinity of the hepatic GH receptor was not influenced by the genotype . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Serum 41 . 5 and 38 . 5 kD BPs have been found to be elevated in acromegaly , where GH hypersecretion causes increased IGF 1 levels , and diminished in cases of genetic or idiopathic GH deficiency and defects of the GH receptor ( Laron ' s syndrome ) , where both IGF 1 and IGF 2 are decreased , as well as in Pygmy adults and children who have isolated IGF 1 deficiency . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Although this extended region has additional segments of localized sequence identity with the human GH receptor , there is no identity with any consensus sequences known to be involved in hormonal signal transduction . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Neuraminidase and tunicamycin treatment demonstrated that the GH receptor on F442A preadipocytes is a sialo glycoprotein with N linked carbohydrate chains . ^^^ This suggests that the structural characteristics of the GH receptor are closely related in each cell type , but that the hormonal signals produced after GH binding to the receptor may cause different effects according to the cell type . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In addition , oPL is one of a small number of hormones that bind the human GH receptor with high affinity . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The rabbit liver GH receptor has recently been purified , sequenced and cloned . ^^^ The GH receptor gene ( s ) has to be studied . ^^^ Studies with monoclonal antibodies against the GH receptor and also sequence analysis and cloning of cDNA from different tissues should help to answer the question of the multiplicity of the GH receptors . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
An RNA probe was generated from this sequence for use in a solution hybridization assay to quantitate GH receptor mRNA expression in rat tissues . ^^^ Hypophysectomy and GH treatment did not affect hepatic GH receptor mRNA levels . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Structural and immunological analyses of the cytosolic GH and PRL receptors in the fetal / early neonatal period revealed similarities with the adult liver cytosolic GH receptor and mammary gland cytosolic PRL receptor , respectively . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The main BP is related to the GH receptor and probably corresponds to the extracellular portion of the receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Mouse serum growth hormone ( GH ) binding protein has GH receptor extracellular and substituted transmembrane domains . ^^^ Predicted amino acid sequences for the mouse GH receptor and the related serum GH binding protein were deducted from cDNAs . ^^^ It is speculated that these two types of clones encode the high and low molecular weight variants of the mouse GH receptor / serum binding proteins , respectively . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
At a supramaximal dose of 1000 ng / ml hGH downregulated GH receptor . ^^^ GH receptor induction was equally seen with hGH , bGH and rGH and did not occur on incubation with oPRL or ACTH . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A soluble GH binding protein , which cross reacted with a monoclonal antibody ( Mab ) to the rabbit liver membrane GH receptor , has been identified in cytosol preparations from both fetal and maternal portions of rabbit placenta . ^^^ Northern blot analysis of fetal and maternal placental mRNA probed with a GH receptor oligonucleotide probe revealed hybridization to a 4 . 4 to 4 . 7 kilobase and a 2 . 2 kilobase species in fetal placenta only . ^^^ Given the relative binding capacities and the demonstration of GH receptor mRNA in fetal placental cytosol , it is highly unlikely that contamination of fetal placental cytosol by fetal serum accounts for all of the placental binding capacity observed . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Thus , the centrally regulated GH secretion in the male rat is complemented by appropriate dynamics of the GH receptor turnover , which in turn recognizes individual pulses and allows individual pulse related responses to occur . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Rapid turnover of the GH receptor has previously been shown , and its turnover ( t1 / 2 ) has been estimated to be 30 85 min . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In humans , deficiency of GH receptor activity probably causes Laron type dwarfism , an autosomal recessive disorder prevalent in Oriental Jews . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The protein coding region of this cDNA was identical in sequence to the extracellular domain of the rat liver GH receptor up to three amino acids before the putative transmembrane domain . ^^^ These results suggest that the mechanism for production of the rat serum GH binding protein is by alternative splicing of the gene for the rat GH receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
All Laron type dwarfism patients had no , or only negligible GH binding protein activity , which supports the evidence that serum GH binding protein corresponds to the extracellular domain of the membranal GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Insulin like growth factor 1 ( IGF 1 ) mRNA and GH receptor mRNA levels were analysed in different tissues from rats made diabetic with streptozotocin , fasted rats and rats fed with a protein reduced diet . ^^^ GH receptor mRNA levels were decreased in heart and diaphragm , but not in liver and kidney . ^^^ Fasting decreased IGF 1 mRNA in all tissues studied except brain , and decreased GH receptor mRNA in liver , heart and diaphragm , but not in kidney . ^^^ A protein reduced diet decreased hepatic IGF 1 mRNA levels but did not significantly affect other tissues , while GH receptor mRNA levels were reduced in liver and diaphragm . ^^^ In conclusion , both diabetes and limited nutrition affected IGF 1 and GH receptor mRNA in different tissues , but the two mRNAs were not co ordinately regulated in all tissues studied . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The data suggest that cAMP dependent phosphorylation of the GH receptor or a closely associated membrane protein renders the receptor incapable of binding GH . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The hydrophilic GH binding protein of serum is a derivative of the GH receptor . ^^^ After sodium dodecyl sulfate polyacrylamide gel electrophoresis in the presence of dithiothreitol the complex migrated with an estimated molecular weight of 100 , 000 whereas [ 125I ] hGH cross linked to the membrane bound GH receptor of the IM 9 cells migrated with an estimated molecular weight of 135 , 000 . ^^^ The smaller size of the binding protein is consistent with its derivation from the extracellular domain of the GH receptor . ^^^ Because the release of this GH binding is greatly augmented by iodoacetamide and N ethylmaleimide , two known sulfhydryl reactive reagents , we suggest that a free sulfhydryl group , either on the GH receptor or on a neighboring protein normally maintains the integrity of the receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Thus , these patients secrete a molecule with normal GH receptor binding and bioactivity which is `` invisible ' ' to the standard GH RIA . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Rabbit liver , a rich source of specific growth hormone ( GH ) receptors , contains three mRNA transcripts ( 4 . 2 4 . 5 kb , 3 . 1 3 . 2 kb , and 1 . 8 2 . 0 kb ) which hybridize strongly to oligonucleotide probes complementary to nucleotide sequences in the extracellular and cytoplasmic regions of the rabbit liver GH receptor . ^^^ These studies have identified the nature of the mRNA transcripts coding for the GH receptor in recognized / potential GH target tissues in the rabbit . ^^^ The regulation of the major GH receptor mRNA in rabbit liver appears to broadly reflect known changes in expressed receptor protein . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Cross linking of solubilized [ 125I ] iodohuman GH receptor complexes with disuccinimidyl suberate followed by analysis by sodium dodecyl sulfate gel electrophoresis in the presence of beta mercaptoethanol and autoradiography resulted in the appearance of bands with apparent mol wt of 113 , 000 , 103 , 000 , 59 , 000 , and 53 , 000 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Competitive displacement curves confirm the somatotropic nature of the GH receptor interaction . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Recent developments have contributed greatly to our understanding of GH receptor structure and function ; however , much remains to be done . ^^^ One of the first priorities should be to elucidate the early events that follow activation of the GH receptor . ^^^ Future studies of the GH receptor in these and other systems will undoubtedly be facilitated by the monoclonal antibody generated against the GH receptor and by recently described cross linking methodologies . ^^^ Despite these recent advances , however , it is likely that detailed characterization of receptor structure and function awaits cloning of the GH receptor gene ( s ) . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Rabbit liver microsomes revealed five [ 125I ] oPRL binding components , three of which were considered to be those of a GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The half time for the GH receptor was 30 40 min , equivalent to a rate constant of approximately 0 . 02 min 1 . ^^^ At 0 . 1 mg / kg cycloheximide , slower disappearance rates were seen for both receptors , and the GH receptor showed a partial recovery . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH receptor induced by frequent or continuous administration of GH was mainly somatogenic , since an excess of unlabeled ovine PRL inhibited GH binding only to a minor extent . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The cytosolic GH binding proteins also cross reacted with a monoclonal antibody to the rabbit liver membrane GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Our studies indicate that the structure of the binding sequence in oPL which binds to the GH receptor of human liver is not identical to the equivalent sequence of hGH and that the monoclonal antibodies compete with GH receptors in human liver for the binding of oPL . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Specificity studies indicated that the hepatic GH receptor was somatogenic , since porcine PRL poorly inhibited [ 125I ] pGH binding ( cross reactivity , 0 . 1 % ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Addition of unlabelled hGH to the culture medium resulted in a marked down regulation of the GH receptor by 2 days . ^^^ The studies to date indicate that the cultured rat adipocyte should provide a useful model for a comprehensive study of the cellular mechanisms and dynamics of GH receptor regulation . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Insulin can regulate IGF 1 production , acting on the GH receptor or at a post receptor site . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These data indicate that in thalassemia major , in addition to the described defect at the hepatic GH receptor or postreceptor level which impedes generation of somatomedins , there may be a marked impairment in somatotroph function . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In conclusion , taking into account that hGH is a Mr 22 , 000 polypeptide , the binding subunit of the GH receptor in human IM 9 lymphocytes has an Mr of approx . 120 , 000 . ^^^ Furthermore , the GH receptor subunit contains asparagine N linked type of oligosaccharide chains . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Monoclonal antibodies raised against the GH receptor will facilitate studies of receptor structure and function . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The eluate from the antibody column contained an Mr 134 , 000 125I GH receptor complex . ^^^ O Phosphotyrosine prevented 125I GH receptor complexes from binding to the antibody column , whereas O phosphoserine and O phosphothreonine did not . ^^^ The molecular weight of 114 , 000 obtained for this protein is similar to that expected for non cross linked GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These differences in responsiveness of the preadipocytes compared to the adipocytes can not be attributed to differences in receptor binding or detectable differences in GH receptor type or size , as determined by migration of [ 125I ] iodohuman GH receptor complexes in electrophoretic gels . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Pure PGH , obtained in small quantities by preparative electrophoresis , was found to bind to hepatic GH receptor with an apparent high potency compared to that of pituitary GH , PGH , thus , should act in vivo as a GH agonist sharing most of its biological properties . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These data suggest that the regulatory mechanism controlling Sm C / IGF 1 production and growth might be different from those that regulate GH receptor concentrations , with GH pulses being crucial for the maximal stimulation of Sm C / IGF and growth , but continuous exposure to GH being required for up regulation of liver GH receptors . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Dissociation of GH receptor complexes was shown not to occur at pH 5 . 5 , the pH encountered in the acidic pre lysosomal compartments ( endosomes ) where intracellular dissociation of many hormone receptor complexes takes place . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The increase in the serum GH binding protein concentration was preceded several days by an increase in the hepatic GH receptor concentration . ^^^ The serum GH binding protein was recognized by antibodies produced against the hepatic GH receptor , and its mol wt ( major form mol wt , approximately 41 , 800 ) was similar to that of low mol wt forms of the hepatic GH receptor , demonstrating the similarity of the serum GH binding protein and the hepatic GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The profound reduction in Sm C / IGF 1 concentrations within a few hours of beginning protein restriction , and the discordance between this reduction and the small decline in somatogenic binding sites , suggests that , in addition to GH receptor loss , a postreceptor defect may participate in the GH resistance occurring in the early stages of protein deficiency . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Two soluble , receptor like binding proteins with apparent somatotrophic [ growth hormone ( GH ) ] and lactogenic [ prolactin ( PRL ) ] specificities , respectively , and that are present in rabbit kidney cytosol have now been examined in more detail using specific GH receptor and PRL receptor monoclonal antibodies ( MAb ) . ^^^ Gel chromatography of 125I labeled human GH ( 125I hGH ) kidney cytosol complexes in the absence of these MAbs revealed two specifically bound regions of radioactivity at molecular weights ( MW ) of approximately 120 , 000 and approximately 60 , 000 , which are similar in size to complexes formed by the native GH receptor of rabbit liver cytosol and the PRL receptor of mammary gland . ^^^ Co incubation with GH receptor MAb inhibited 125I hGH binding only to the higher MW ( 120 , 000 ) species , whereas the PRL receptor MAb inhibited only the lower MW ( 60 , 000 ) species , thus establishing definitively the hormonal specificities of the two binding proteins . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This protein has the same restricted specificity for hGH as the membrane bound GH receptor . ^^^ To determine whether the GH binding protein is a derivative of , or otherwise related to , the GH receptor , we have examined the serum of three patients with Laron type dwarfism , a condition in which GH refractoriness has been attributed to a defect in the GH receptor . ^^^ We suggest that the serum GH binding protein is a soluble derivative of the GH receptor . ^^^ Measurement of the serum GH binding protein may permit recognition of other abnormalities of the GH receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This suggests that binding to a type of GH receptor is the first step in PRL receptor induction . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
It is not clear whether the Mr approximately 100 , 000 form , or perhaps higher Mr species which have not been identified by cross linking studies , represents the native , endogenous , form of the GH receptor present in particulate microsomal or plasma membranes . ^^^ Accordingly , although these data have identified two classes of GH binding protein , especially a primary GH binding subunit of Mr 60 , 000 66 , 000 , they indicate that , unlike studies on the insulin receptor , covalent cross linking techniques alone are not sufficient to delineate the complete subunit structure of the native and endogenous form of the GH receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Taken together with binding studies , these findings suggest that differences in the ability of GH to stimulate glucose oxidation in rat adipose tissue probably involve differences distal to the GH receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Because its specificity is similar to that of the GH receptor , we considered the possibility that it represented a circulating receptor subunit or fragment . ^^^ Laron type dwarfism is a rare disorder characterized by severe growth failure , resistance to GH , and GH receptor deficiency . ^^^ This finding suggests that the circulating GH BP is related to and / or may be derived from the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The ontogeny of serum GH binding protein in man : a possible indicator of hepatic GH receptor development . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Ontogenesis of growth hormone ( GH ) responsive hepatic gene products : lack of correlation with hepatic GH receptor content . ^^^ The ontogenesis of hepatic GH receptor content is postulated as a major determinant of expression of hepatic GH responsive gene products , since the ontogeny of the receptors and the responsive gene products , somatomedin C , somatomedin binding protein , and GH responsive acidic protein , have similar qualitatively ontogenetic patterns . ^^^ During the time of increasing GH receptor content ( 2 35 days ) , S 16 , attenuated by GH 2 fold in the adult , increased 6 fold . ^^^ We conclude that GH receptor content is not the sole determinant for the ontogenetic expression of GH responsive products and that important alternate mechanisms exist for their regulation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The apparent lactogenic specificity was confirmed by a lack of cross reactivity of the binding protein with an anti [ GH receptor ( rabbit liver ) ] monoclonal antibody . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
At 6 , 8 , and 20 weeks of age , hepatic GH receptor binding in the Hubbard SLD chickens was significantly lower than that of normal fast growing birds . ^^^ We further examined hepatic GH receptor binding in two closely related White Leghorn strains of chickens that have been maintained as closed breeding populations for many years . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The results show that insulin and thyroxine may be important for the GH receptor and the insulin like effect of GH in adipocytes . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These data suggest that the isolated rat adipocyte should be a useful model for further investigation of the relationship between GH receptor and post receptor events . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The recent observation that adipose conversion of mouse 3T3 fibroblasts is stimulated by physiological concentrations of human GH ( hGH ) and rat GH in vitro suggested that this cell line may be suitable for the study of GH receptor interactions . ^^^ The half time of GH receptor loss after inhibition of protein synthesis with cycloheximide ( 0 . 1 mM ) was 1 . 25 + / 0 . 14 h , n = 3 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Turkey PRL , and chicken LH and FSH showed no inhibition of the 125I labeled chicken GH hepatic binding and the ontogeny of the hepatic GH receptor binding sites in male and female chickens was examined . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
No change in binding is observed 25 days after fetal decapitation at 69 days ( n = 3 ) , suggesting that circulating GH does not down regulate the fetal GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Immunologic evidence of differences between mammary gland , adrenal , ovary , and liver PRL receptors was also obtained , although the degree of difference in the liver receptor was obscured by binding of 125I ovine PRL to the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Monoclonal antibodies to the GH receptor ( GHR ) have been produced by the application of hybridoma technology to splenic lymphocytes from BALB / C mice immunized with a human ( hGH ) affinity purified preparation of rabbit liver GHR . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These results suggest that neither NSILA S inhibitors , abnormal GH molecules , nor hepatic damage contribute to the failure of these patients to produce NSILA S and that a specific defect may exist at the hepatic GH receptor or postreceptor level . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Characteristics of hepatic GH receptor from rabbit ( author ' s transl ) ] . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Thus , it would appear that the mechanism of regulation of GH receptors by GH itself is different in this animal model of GH deficiency than in the Snell dwarf mouse and the hypophysectomized rat , where GH receptor levels are very low or absent . ^^^ The failure of lit / lit mice to grow normally despite normal levels of GH receptor raises questions regarding the site and mechanism of the growth defect in the little mouse . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A CB6F1 / J mouse was immunized over a period of 82 days with a partially purified GH receptor ( GHr ) preparation . ^^^ Preliminary experiments indicate that the antibody will be helpful in purification of the rabbit liver GH receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The mouse fibroblast GH receptor may provide a useful model for somatogenic receptors , particularly if it is coupled to somatomedin production as appears to be the case with human fibroblasts . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Our data indicate that the GH receptor in rat liver binds 20K with an affinity only slightly lower than that for hGH ( 22K ) , in accordance with bioassay data . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Similar GH receptor characteristics were found on each of the fibroblast cell lines examined irrespective of the site of origin ( skin or lung ) or age of donor . ^^^ On the basis of these studies we suggest that cultured skin fibroblasts may be a suitable tissue for the study of GH receptor status in patients with disorders of growth . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This treatment normalized Sm C levels and partially restored the GH binding capacity ( treated : 49 + / 4 fmol / mg protein versus untreated diabetics : 28 + / 6 fmol / mg protein ; P less than 0 . 01 and versus controls : 68 + / 4 fmol / mg protein ; P less than 0 . 05 ) . 2+ suggest that in an early phase of nonketotic diabetes , the low plasma Sm C is not due primarily to reduced GH receptor number . ( ABSTRACT TRUNCATED AT 250 WORDS ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In the absence of reductant , the affinity labeled GH receptor migrated as a broad band of Mr = 116 , 000 125 , 000 and as a less intense band of Mr = 230 , 000 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
It thus appears that the GH receptor contains a 130 kilodalton subunit , a portion of which is in disulfide linkage with higher molecular weight complexes and , in addition , contains a 56 kilodalton species . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The ability of a concanavalin A Sepharose affinity column to also bind the cytosolic binding protein indicates that , like the membrane bound GH receptor , it is a glycoprotein . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The mechanism for this deficiency has been proposed to result from a defect at the GH receptor level or at a site distal to the receptor in the pathway leading to NSILA S generation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have recognized five patients who responded to GH administration with an increase in serum Sm and an acceleration in skeletal growth , and have characterized the circulating GH in an homologous human GH radioreceptor assay employing the IM 9 lymphocyte as a source of human GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This form appears apparently with the development of GH receptor in livers , suggesting the possibility that a factor independent from androgen and GH governs the ontogeny of this P 450 in the liver . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Liver GH receptor mRNA levels at adulthood were not significantly altered by neonatal MSG treatment , suggesting that the unresponsiveness of MSG treated females and the previously reported low responsiveness of MSG treated males to GH induced CYP 2C11 expression are not due to the absence of GH receptor . ^^^ Moreover , normal liver IGF 1 mRNA levels were expressed in the MSG treated female rats , suggesting that the liver GH receptor is functional in these animals . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Hypothalamic GH receptor gene expression in the rat : effects of altered GH status . ^^^ We therefore used in situ hybridization histochemistry to investigate the effects of GH status on hypothalamic GH receptor gene expression , using hypophysectomized normal and dw / dw dwarf rats as models of acquired and congenital GH deficiency . ^^^ Hypophysectomy resulted in a time dependent reduction in GH receptor gene expression . ^^^ ARC GH receptor transcripts in untreated dw / dw dwarf rats were half those found in normal animals of the same background strain ( 16 . 8 + / 1 . 7 vs 9 . 3 + / 1 . 9 d . p . m . / mg , P < 0 . 05 ) . ^^^ Increasing circulating GH by peripheral infusion of 200 micrograms human GH ( hGH ) / day for 6 days increased ARC GH receptor expression in dw / dw rats to normal . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The present study was undertaken to investigate the possible effect of K+ deficiency on the hepatic GH receptor and GH binding protein ( BP ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Based upon recent findings that GH and interferons activate JAK family tyrosine kinases , we have identified a novel signaling pathway leading from the GH receptor to the nucleus . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Porcine and bovine GH receptor ( GHR ) cDNAs were stably expressed in mouse L cells , which normally do not possess detectable levels of mouse GHR . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The high affinity GHBP represents a circulating fragment of the GH receptor , encompassing its extracellular domain . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The effects on growth parameters , serum IGF 1 concentration , body composition and hepatic GH receptor binding were assessed . bGH treated animals showed increases in body weight gain ( p = 0 . 01 ) , serum IGF 1 ( p < 0 . 01 ) , carcass nitrogen ( p < 0 . 001 ) and carcass water ( p < 0 . 001 ) compared to IGF 1 or saline treated animals . ^^^ No differences in these parameters were noted between IGF 1 and saline treated groups . bGH treated animals showed a significantly lower hepatic GH receptor binding ( p < 0 . 01 ) compared to the other two groups . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These results suggest that the GH independent growth in this model could result from direct effects of hyperinsulinism on circulating IGF 1 and IGFBP 3 levels and / or indirect effects through increased GH receptor function . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH receptor , a member of the cytokine receptor superfamily , does not demonstrate homology with any known tyrosine kinases . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH binding protein ( GHBP ) or GH receptor is present in numerous extrahepatic tissues in the rodent . ^^^ RNA was isolated from placentas and subjected to Northern analysis using a cDNA probe to the shared region of GHBP and GH receptor encoding mRNAs . ^^^ The GH receptor encoding mRNA ( 4 . 2 kb ) increased sixfold by day 14 and then remained steady until day 18 . ^^^ Three GH receptor / GHBP mRNA species of 8 , 4 . 2 and 1 . 4 kb were observed . ^^^ GHBP and GH receptor encoding mRNAs are not co ordinately regulated in vivo or in vitro . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptor mRNA is coexpressed with ALS in liver and kidney , suggesting that the effects of GH on ALS gene expression may be direct . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The levels of GH receptor mRNA were positively correlated with overall growth rate ( P < 0 . 005 ) in liver and negatively correlated ( P < 0 . 05 ) in muscle , indicating distinct tissue specific effects of energy status . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The absence of GH receptor ( GHR ) messenger RNA would mitigate against a direct ovarian effect . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Among them , the first and the second produce small loops ( roughly 10 amino acid residues ) as found in the human GH receptor . ^^^ These results suggested that the mBN domain of the G CSF receptor expressed by E . coli has a GH receptor like structure . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Therefore , the aim of future GH immunoassays must be the identification of antibodies that bind with high affinity only those forms of human GH that bind and activate the GH receptor . ^^^ It has recently been shown that one molecule of human GH binds two molecules of GH receptor , and dimerization of the receptor by its ligand is a prerequisite for biological function . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Furthermore , dimerization of the GH receptor appears to be necessary for GH stimulated tyrosine phosphorylation of JAK 2 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
IGFs circulate bound to high affinity binding proteins ( IGFBPs ) which modulate their actions , and circulating GH may be associated with two binding proteins ( GHBPs ) of which the high affinity GHBP has been characterized and is structurally identical to the extracellular domain of the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Transcriptional regulation by growth hormone ( GH ) represents the culmination of signal transduction pathways that are initiated by the cell surface GH receptor and are targeted to the nucleus . ^^^ Recent studies have demonstrated that the activated GH receptor can stimulate Stat 1 , a cytoplasmic transcription factor that becomes tyrosine phosphorylated and translocates to the nucleus , where it can interact with specific DNA sequences to modulate gene expression . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
There were no changes in GH receptor or IGF 1 receptor mRNA levels in Hx or bGH or rhIGF 1 treated animals . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
OBJECTIVE : Laron syndrome is a genetic disease due to a defect in the GH receptor or in the post receptor mechanism which leads to an inability to generate IGF 1 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In the present study , a series of GH receptor ( GHR ) truncation analogs were constructed and examined for their abilities to induce pp 95 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A single form of GH receptor ( GHR ) messenger RNA ( mRNA ) of 4 . 5 kilobases , encoding the full length GHR , has been found in man . ^^^ In 7 muscle biopsies , GH receptor mRNA varied between 4 . 0 + / 0 . 4 and 34 . 6 + / 1 . 4 10 10 ( 4 ) molecules / micrograms total RNA . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The widespread expression of the PRL and GH receptor transcripts in gastric and intestinal mucosal lineages , particularly in epithelia , suggests regulatory roles of these hormones on digestive and immune functions , including metabolism , growth , or differentiation . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of the human GH receptor in the mouse promyeloid , interleukin 3 dependent cell line , FDC P 1 , shows that this receptor can signal ligand dependent proliferation in these cells as well as induce the tyrosine phosphorylation of Jak 2 and the activation of transcription factors . ^^^ We now examine the requirement for tyrosine phosphorylation of the GH receptor for these three events by expression of a receptor without tyrosine residues in the intracellular domain . ^^^ Six of the seven intracellular tyrosine residues were removed by a carboxyl terminal truncation , and the remaining tyrosine was changed to phenylalanine to yield the GH receptor D351Stop / Y314F . ^^^ Thus , tyrosine phosphorylation of the GH receptor is not essential for the signaling of these three events at least in this system . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To gain insight into pathways coupling GH receptor ( GHR ) to MAP kinase activation and signaling molecules that might interact with GHR and its associated tyrosine kinase JAK 2 , we examined whether SHC and Grb 2 proteins serve as signaling molecules for GH . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH insensitivity due to GH receptor deficiency is a rare autosomal recessive condition , characterized by deletions or mutations of the GH receptor gene . ^^^ Therapy with recombinant human insulin like growth factor 1 ( rhIGF 1 ) can bypass the defect in the GH receptor and potentially stimulate growth . ^^^ One recipient of rhIGF 1 developed papilledema , which resolved spontaneously . rhIGF 1 therapy did not alter serum IGF binding protein 3 concentrations . rhIGF 1 treatment is effective in stimulating skeletal growth in GH receptor deficiency . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
OBJECTIVE : The aim of this investigation was to study the effect of relatively high dose IGF 1 therapy given for several months , on serum levels of IGF 1 , IGF 2 and IGFBP 3 , and on IGF 1 pharmacokinetics in patients with growth hormone insensitivity due to GH receptor dysfunction . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Dimerization of the GH receptor after ligand binding leads to the rapid association and tyrosine phosphorylation of the intracellular kinase , Jak 2 , as well as to the tyrosine phosphorylation and activation of STAT protein ( s ) . ^^^ Carboxyl terminal truncations of the human GH receptor have been used to demonstrate that a 54 amino acid , intracellular region of the receptor is sufficient to signal cell proliferation in response to ligand binding . ^^^ A consistent pattern of proliferation , Jak 2 phosphorylation , and transcription factor activation was found for the 10 GH receptor mutants , a finding that is consistent with the hypothesis that the Jak STAT pathway is required for the signaling of proliferation in these cells . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) treatment of cells promotes activation of JAK 2 , a GH receptor ( GHR ) associated tyrosine kinase . ^^^ Growth hormone ( GH ) treatment of cells promotes activation of JAK 2 , a GH receptor ( GHR ) associated tyrosine kinase . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The presence of low IGFBP 3 and IGF 1 levels in a short child with normal GH response to provocative tests should prompt further investigations , such as the determination of spontaneous GH secretion or assessment of the GH binding proteins together with an IGF 1 and / or IGFBP 3 generation test , in order to identify neurosecretory dysfunction or GH receptor deficiency . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptor binding is positively modulated by a number of factors , including retinoic acid and dexamethasone , whereas fetal calf serum strongly decreases the binding . ^^^ Further , IGF 1 and 2 decreased GH receptor messenger RNA ( mRNA ) levels , as quantified by a solution hybridization ribonuclease protection assay , from 8 . 65 + / 1 . 78 attomoles ( amol ) / microgram DNA ( control ) to 2 . 4 + / 0 . 68 and 2 . 16 + / 0 . 92 amol / microgram DNA , respectively . ^^^ IGFBP 2 increased GH receptor mRNA levels from 5 . 26 + / 1 . 17 ( control ) to 13 . 19 + / 3 . 48 . ^^^ Incubation with IGFBP 3 did not result in stimulation of GH receptor mRNA levels ( 8 . 59 + / 2 . 91 amol / microgram DNA ) . ^^^ This shows that the mechanism of regulation of the GH receptor is , except for IGFBP 3 , at least in part on the mRNA level . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Although the receptor for growth hormone ( GH ) does not contain intrinsic tyrosine kinase activity , GH has recently been shown to promote the association of its receptor with JAK 2 tyrosine kinase , to activate JAK 2 , and to promote the tyrosyl phosphorylation of both GH receptor ( GHR ) and JAK 2 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Our present study agrees with the notion that GH must bind to the GH receptor via site one and with a second GH receptor molecule ( or with some yet unidentified ' second target ' ) through GH binding site two . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Some children with idiopathic short stature have low serum concentrations of GH binding protein , which is derived from the GH receptor . ^^^ The possibility that low serum concentrations of GH binding protein might indicate partial insensitivity to GH led us to investigate possible defects in the gene for the GH receptor in children with idiopathic short stature and low serum concentrations of GH binding protein . ^^^ Analysis of single strand conformation polymorphisms and DNA sequencing were both used to identify mutations in the GH receptor gene . ^^^ Mutations in the region of the GH receptor gene that codes for the extracellular domain of the receptor were found in 4 of the 14 children , but in none of 24 normal subjects . ^^^ Some children with idiopathic short stature may have partial insensitivity to GH due to mutations in the GH receptor gene . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Two mechanisms of production of the GH BP have been described : in the human and the rabbit , the GH BP is cleaved near the cellular membrane by proteolysis and shed into the extracellular compartment while in murine species , the serum GH BP is produced by alternative splicing of the gene coding for the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Following the growth hormone ( GH ) and GH receptor ( R ) interaction , the receptor and Janus tyrosine kinase 2 ( JAK 2 ) become tyrosine phosphorylated along with other intracellular proteins . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have shown previously that growth hormone ( GH ) induced tyrosine phosphorylation of a 95 kDa protein in mouse L cells stably transfected with the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The levels of estrogen receptor ( ER ) , epidermal growth factor ( EGF ) receptor ( EGF R ) and GH receptor ( GHR ) in the mammary glands of the animals were also measured . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
CONCLUSIONS : Adults with chronic liver disease have ( 1 ) increased total daily GH secretion rates , which appear to be influenced by disease severity and diminished serum IGF 1 mediated negative feedback ; ( 2 ) markedly impaired endogenous GH clearance , possibly reflecting changes in hepatic GH receptor status ; and ( 3 ) GHBP levels which do not correlate with GH kinetics or serum IGF 1 concentrations . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The increasing use of GH therapy has led to the description of its target cells in human tissues , but no data are yet available on the localization of the GH receptor in the human pituitary . ^^^ In the present study , we used immunocytochemistry to detect the presence of GH receptor / binding protein ( GHR / BP ) , and we examined its distribution among the different types of human anterior pituitary cells . ^^^ Immunocytochemistry was performed by using monoclonal antibody 263 raised against purified rat and rabbit GHR / BP , which cross reacts with the human GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The human GH receptor ( GHR ) exists in two known isoforms ; in one form exon 3 is present ( GHR3+ ) , and in the other , exon 3 is absent ( GHR 3 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
More recently , adults and children with IDDM have been found to have low levels of the high affinity growth hormone binding protein ( GHBP ) , which represents the extracellular portion of the GH receptor , and is thought to reflect GH receptor tissue concentrations . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The high affinity GHBP represents the ectodomain of the GH receptor ( GHR ) ; it is either cleaved from membrane bound GHRs ( man , rabbit ) or derived from an alternatively spliced GHR mRNA ( rodents ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
First , we demonstrated that specific transcripts corresponding to the GH receptor ( 4 . 5 kilobases ) and to the GH binding protein ( 1 . 2 kilobases ) were expressed in the normal rat prostate , but also in all prostatic carcinoma cell lines tested ( LNCaP , PC 3 , MAT Lu , MAT LyLu , and Pif 1 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Treatment with recombinant IGF 1 has been shown to normalise growth in children with GH receptor deficiency . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Here we used Chinese hamster ovary K 1 cells transiently cotransfected with rabbit GH receptor and c fos promoter luciferase constructs to demonstrate that the major region responsible for GH induction is located between 284 396 base pairs upstream of the transcription start site . ^^^ These results indicate that GH receptor and c fms tyrosine kinase operate through multiple common response elements to regulate c fos gene expression despite their structural differences . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Plasma IGF 1 is regulated by GH released from the pituitary gland , and although data demonstrate a decline in GH secretion with age , GH receptor ( GHR ) density in liver tissue has been reported to increase . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Thus we provide the first experimental evidence that specific tyrosine residues of the GH receptor are required for selected cellular responses to GH . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These results define the importance of the membrane proximal 80 amino acids of the GH receptor ( with the conserved box 1 and box 2 domains ) with regard to GH activation of both Jak 2 and Stat ( s ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These results indicate that the endometrial binding site for bPL is antigenically similar to the bGH receptor and raise the possibility that it may be a modified GH receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To investigate the possibility that tyrosine phosphorylation of cellular proteins might play a role in GH receptor signaling , we have studied tyrosine phosphorylation induced by GH and by GH mutants in the human lymphocyte line IM 9 , a homologous cell system which is known to respond to GH by increased proliferation . ^^^ Previous biophysical analysis of these mutant GH proteins has shown that the GH protein contains two distinct binding sites which interact in a sequential manner with the extracellular domains of two distinct GH receptor molecules , thus forming a dimeric complex . ^^^ By treating IM 9 cells with these same GH mutants and analyzing tyrosine phosphorylation , we found that tyrosine phosphorylation was inhibited under conditions which prevent receptor dimerization , thus providing evidence that formation of a dimeric GH : ( GH receptor ) 2 complex may be important for intracellular signaling by the GH receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have identified 56 patients with GH receptor deficiency ( Laron syndrome ) from two provinces in southern Ecuador , one group of 26 ( Loja province ) with a 4 : 1 female predominance and 30 patients from neighboring El Oro province with a normal sex ratio . ^^^ GH binding protein , the circulating extracellular domain of the GH receptor , was measured by ligand immunofunction assay and found to be comparably low in children and adults . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We addressed this question in six patients with Laron type dwarfism , a syndrome characterized by the absence of GH receptor activity ( LTD ) , who were chronically treated with recombinant IGF 1 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Northern blot analysis of FTC 5 : 3 with a 32P labeled RNA probe complementary to an extracellular part of the rat GH receptor , revealed two major labeled bands ( 4 . 0 and 1 . 2 kilobases ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH deficiency , fasting , IGF 1 administration to patients with GH receptor deficiency , hepatic failure and insulinomas caused a moderate increase of serum IGFBP 2 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In order to determine potential sites of action of GH in the human fetus , we have used a combination of immunocytochemistry and northern blotting to examine human fetal tissues for GH receptor or binding protein and its messenger RNA . ^^^ Decalcified paraffin sections , were prepared for immunostaining with a monoclonal antibody to the GH receptor or control antibodies . ^^^ Positive immunostaining for GH receptor was seen in growth plate , including chondrocytes in the proliferative and hypertrophic zones , perichondrium , osteoblasts , and erythroid precursor cells . ^^^ GH receptor immunostaining was also seen in skin sections throughout epidermis , including sebaceous and sweat glands , and vessels and fibroblasts in the dermis . ^^^ Skin fibroblasts showed uniform GH receptor immunostaining . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Profound growth failure despite elevated GH levels in GH receptor deficiency ( GHRD ) results from reduced insulin like growth factor 1 ( IGF 1 ) synthesis . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) stimulates insulin like growth factor 1 ( IGF 1 ) and IGF 1 binding protein 3 , but not GH receptor gene expression in livers of juvenile rats . ^^^ In the adult rat , expression of the liver GH receptor , insulin like growth factor 1 ( IGF 1 ) , and IGF 1 binding protein 3 ( IGFBP 3 ) genes has been shown to be under GH control . ^^^ To further elucidate the time of appearance and the extent of GH control of liver GH receptor , IGF 1 , and IGFBP 3 gene expression , we studied the effect of hypophysectomy and GH and IGF 1 treatment in juvenile rats . ^^^ No changes in GH receptor or GH binding protein mRNA levels were caused by Hx , GH , or IGF 1 treatment . ( ABSTRACT TRUNCATED AT 400 WORDS ) . ^^^ Growth hormone ( GH ) stimulates insulin like growth factor 1 ( IGF 1 ) and IGF 1 binding protein 3 , but not GH receptor gene expression in livers of juvenile rats . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Activation of the GH receptor ( GHR ) results in tyrosine phosphorylation of cellular proteins , and this tyrosine phosphorylation is believed to be important in GH action . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The biological effects of growth hormone ( GH ) are initiated by its binding to the GH receptor ( GHR ) followed by association and activation of the tyrosine kinase JAK 2 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We performed immunohistochemistry using specific monoclonal antibodies against human GH receptor on 51 specimens of pre menopausal human ovaries from various phases of the menstrual cycle to detect and localize GH receptors . ^^^ GH receptor immunoreactivity was observed in luteinized granulosa cells in corpora lutea in the luteal phase , which are considered to be active in steroid production . ^^^ In the follicular phase , GH receptor immunoreactivity was detected in the granulosa layer of only three out of 35 antral follicles . ^^^ These results demonstrate that immunoreactivity of GH receptor is present in human ovaries , suggesting a direct action of GH on human ovarian functions , especially during luteal phase . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To identify DNA sequences involved in the regulation of transcription of the murine GH receptor gene , a 17 kilobase genomic clone containing the 5 ' flanking region , exon 1 , and part of intron 1 of the murine GH receptor gene was isolated . ^^^ Analysis of both functional activity and DNA protein binding activity of this enhancer element in adult and fetal hepatocytes suggests that this DNA element may play a role in the developmental expression of the GH receptor gene . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Substitution of arginine for glycine at position 120 in native 22 kDa human growth hormone ( hGH ) results in an analogue , G120R , which is unable to dimerize the GH receptor and is widely used to probe the molecular mechanism of action of hGH . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Erythropoietin ( EPO ) and growth hormone ( GH ) stimulate the DNA binding activity of MGF Stat 5 in COS cells transfected with vectors encoding EPO receptor and MGF Stat 5 or vectors encoding GH receptor and MGF Stat 5 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This syndrome is a unique model that enables study of the GH receptor , its signal transduction , and the comparison between the effects of GH and insulin like growth factor I . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In the present study , the preferential utilisation of a GC rich 5 ' UTR , designated exon 1B , was observed following the isolation of ovine ( o ) GH receptor cDNA clones from a skeletal muscle cDNA library . ^^^ Although exon 1B oGH receptor mRNA was expressed in all tissues examined , marked differences in the level of expression relative to the whole GH receptor transcript pool were observed between tissues . ^^^ The emerging complexity of the 5 ' regulatory region of the GH receptor gene was emphasised by the observation that probes derived from exon 1B and the distal 3 ' intron boundary do not hybridise with previously cloned genomic sequences that span the liver specific P 1 promoter and exon 2 . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Northern blot analysis showed two mRNA species of 4 and 1 . 6 kb for the GH receptor and , one major species of 10 . 5 kb for the PRL receptor . ^^^ On the contrary , bGH and rPRL , down regulated the expression of GH receptor gene . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The ability of GH receptor ( GHR ) to transduce the signal for IRS 1 tyrosyl phosphorylation is mediated by the intracellular region of GHR between amino acids 295 and 380 by a mechanism not involving the two tyrosines in this region . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
However , future research emphasis on the regulation of GH receptor binding activity and gene expression and their relationship to GH action , as well as on newer components of the GH axis such as GH binding proteins , will help to clarify controlling mechanisms in poultry . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Two 5 ' untranslated regions ( 5 ' UTRs ) with distinctly different sequences , designated 5 ' UTR L 1 and 5 ' UTR L 2 , were obtained by amplification of complementary DNA from mouse liver and placenta with primers complementary to sequences from the hormone binding domain common to GH receptor ( GHR ) and GH binding protein ( GHBP ) messenger RNAs ( mRNAs ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Pituitary growth hormone ( GH ) acts as a growth promoter in a wide range of tissues after binding to its specific GH receptor ( GHR ) or to a cytosolic circulating GH binding protein ( GHBP ) . ^^^ Pituitary growth hormone ( GH ) acts as a growth promoter in a wide range of tissues after binding to its specific GH receptor ( GHR ) or to a cytosolic circulating GH binding protein ( GHBP ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
By Northern blot analysis , using a human GH receptor cDNA probe , the classically observed 4 . 7 kilobase GH receptor mRNA was evidenced in 2 of 29 cancer biopsies and in the MCF 7 and T 47 D cell lines . ^^^ Reverse transcription coupled to PCR was used to amplify the GH receptor sequence encompassing a part of the extracellular domain as well as the transmembrane domain . ^^^ The reverse transcription PCR product was shown to be specific by Southern blot hybridization with the GH receptor cDNA probe and by specific cleavage of the amplified products with restriction enzymes . ^^^ For the first time , the expression of GH receptor gene in breast cancer cell lines and biopsies is demonstrated in this study , suggesting a GH specific action in tumor development . ^^^ Additionally , the two isoforms of the human GH receptor ( hGHR ) mRNA , one containing exon 3 ( hGHR wt mRNA ) and one excluding exon 3 ( hGHR d 3 mRNA ) , were found to be expressed independently or simultaneously ( 29 tumors analyzed ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These results suggested that the oligomeric mechanism of the G CSF receptor differs from that reported for growth hormone ( GH ) receptor , although CD spectrum spectroscopy suggested that the Ig CRH has a GH receptor like structure . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In the rat , the GH receptor ( GHR ) and the GH binding protein ( GHBP ) , which arise from alternative splicing of the same gene , show a sexually dimorphic and GH dependent expression pattern . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH binding protein ( GHBP ) in rodents consists of a ligand binding domain , which is identical to the extracellular portion of the GH receptor ( GHR ) , and a hydrophilic carboxyl terminal domain , in place of the transmembrane and intracellular domains of the GHR . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Control of growth hormone ( GH ) binding protein release from human hepatoma cells expressing full length GH receptor . ^^^ In humans and rabbits , the circulating GH binding protein ( GHBP ) is released from the GH receptor by cleavage at a site proximal to the cell surface . ^^^ There is evidence that GHBP status is predictive of GH responsiveness , presumably because it reflects GH receptor status . ^^^ Human HepG 2 cells were stably transfected with rabbit GH receptor and shown to be responsive to nonprimate ( bovine ) GH , indicating functionality of the transfected receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Body growth , blood glucose , serum insulin like growth factor 1 levels , liver GH receptor ( GHR ) binding , and kidney histology of these animals were evaluated . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In the rat , alternatively spliced messenger RNA ( mRNA ) species encode GH receptor ( GHR ) and GH binding protein ( GHBP ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Monocytes specifically bound radiolabeled GH and contained mRNA for the GH receptor and , in some donors , the PRL receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Furthermore , transcripts for insulin receptor , type 1 and 2 IGF receptors , and GH receptor could be amplified by polymerase chain reaction analysis from the pancreas and the ICCs . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
One monoclonal antibody ( 8H7 ) produced against synthetic peptide ( amino acids 54 63 of the extracellular domain of the bovine GH receptor ) specifically interacted with 190 and 58 kDa bands while the 31 kDa band was not recognized . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of the prolactin receptor ( PRL r ; female > male ) and the steroid 5 alpha reductase ( female > male ) genes was decreased in male nodules , whereas no difference was observed with respect to GH receptor ( GH r ; female > male ) expression in nodules versus surrounding tissue . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The ' high affinity ' growth hormone binding protein ( GHBP ) corresponds to the extracellular domain of the membrane associated GH receptor . ^^^ In man , it is produced by proteolytic cleavage of the extracellular portion of the receptor , while in the rat and mouse , it is the product of alternative splicing of GH receptor mRNA . ^^^ Because of the relationship between the GHBP and the GH receptor , measurement of serum concentrations of GHBP provide an index of GH receptor concentrations and / or affinity . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH receptor and signal transduction . ^^^ The transcriptional activity of wild type and mutant forms of GH receptor has been determined by co transfecting the promoter of a GH responsive gene , coupled to CAT along with the receptor cDNA . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In this report we examine the acute actions of GH with a focus on the intracellular signaling pathways leading from the cell surface GH receptor into the nucleus , and culminating in the activation of specific target genes . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Primary growth hormone ( GH ) insensitivity ( Laron syndrome ) is a hereditary disease due to polymorphic defects in the GH receptor , or in the postreceptor mechanisms , leading to an inability to generate IGF 1 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Binding assay , Northern blot , and reverse transcriptase polymerase chain reaction ( RT PCR ) techniques were used for GH receptor ( GHR ) detection . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Hypophysectomy was without effect on liver GH receptor binding activity , but increased liver 5 ' monodeiodinase activity . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Low food intake ( 50 % that of rats fed ad libitum ) resulted in a reduced number of GH receptors in liver membranes and a low plasma level of GH binding protein ( GHBP ) ; GH receptor gene expression in the liver , as analyzed by Northern blots , was not significantly lower in normal food restricted animals . ^^^ In uremia , the GH receptor dysfunction is not only at a transcriptional level but also at a post transcriptional level . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In 120 to 150 g female Sprague Dawley rats , we measured the effects of rhGH and rhIGF 1 and their combination by the following parameters : kidney weight / body weight ratio , DNA / protein ratio , mRNA of GH receptor and of IGF 1 , mitosis index and PCNA ( by immunohistology ) , zonal architecture and glomerular diameter by micromorphometry . ^^^ Addition of high doses of rhGH to high doses of rhIGF 1 caused no further increase of the ratio despite a significant further increase of body weight . rhGH increased the abundance of renal GH receptor mRNA ( 0 . 46 + / 0 . 32 amol / microgram DNA vs . 0 . 08 + / 0 . 07 in controls ) and of IGF 1 mRNA ( 1 . 35 + / 0 . 5 pg / micrograms DNA vs . 0 . 35 + / 0 . 17 ) , whereas no change was seen with IGF 1 treatment . rhGH and rhIGF 1 increased kidney DNA / protein ratio , mitoses and PCNA expression in various renal structures . ( ABSTRACT TRUNCATED AT 250 WORDS ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Introduction of a second Ca2+ binding site adjacent to the first by a second charge reversal ( K30E R34E pGH ) further increased Ca2+ dependence of binding and also increased affinity for the rabbit GH receptor ( 2 . 4 + / 0 . 4 ) fold relative to wild type pGH at optimal Ca2+ . ^^^ A third partial charge reversal mutant in the fourth helix ( H170D ) also led to enhanced Ca2+ dependence of binding , supporting our proposal that E 34 and D 170 are responsible for the Ca2+ dependence of hGH binding to the rabbit GH receptor . ^^^ As well as extending the binding site model of GH , these studies provide a mechanistic explanation for the unique Ca2+ dependence of hGH binding to the rabbit GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH receptor ( GHR ) is a member of the cytokine / hematopoietic growth factor family , and protein tyrosine phosphorylation has been implicated in the signaling cascade of these receptors . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In addition , immunohistochemical localization of the GH receptor and insulin like growth factor 1 was determined by the streptavidin biotin peroxidase technique . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A GH receptor defect , which was hypothesized as the cause of the disease , was demonstrated after the cloning of the GH receptor cDNA . ^^^ Several abnormalities of the GH receptor gene have been identified in the patients , demonstrating the genetic heterogeneity of the disease . ^^^ In other situations of growth failure , such as in the Pygmies , a defect in the regulation of the GH receptor gene expression has been proposed . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The recently described GH binding protein ( BP ) may reflect the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Eight different mutations were detected in the growth hormone ( GH ) receptor gene of patients with inherited GH receptor deficiency ( GHRD ; Laron syndrome ) from five continents . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of heterozygosity for the defect in the growth hormone ( GH ) receptor has been proposed to be reflected in stature , and in GH binding protein ( GHBP ) and insulin like growth factor 1 ( IGF 1 ) levels in parents and other relatives of patients with GH receptor deficiency ( GHRD ; Laron syndrome ) . ^^^ It has previously been demonstrated that 17 parents heterozygous for the Ecuadorean mutation of the GH receptor differed little in biochemical measures ( GHBP , IGF 1 , IGF 2 , IGFBP 2 and IGFBP 3 ) from Ecuadorean controls . ^^^ Thus , although there may be slight heterozygote expression of the defective gene for the GH receptor , there is no rationale for counselling based on such minimal variation . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Genotypic and phenotypic heterogeneity in patients with growth hormone ( GH ) insensitivity syndrome suggests that partial defects exist in the GH receptor . ^^^ The insulin like growth factor 1 ( IGF 1 ) generation test was assessed as a means of identifying partial GH receptor defects in a heterogeneous group of 22 prepubertal children with short stature . ^^^ Despite this , the IGF 1 generation test has been extremely useful in the confirmation of the diagnosis of GHIS and may therefore also prove useful in the confirmation of partial defects in the GH receptor . ^^^ A subgroup of short children with peak GH levels above 40 mU / l had some characteristics of partial GH receptor deficiency . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
OBJECTIVE : It has been proposed that the dissociation between growth hormone secretion and insulin like growth factor 1 ( IGF 1 ) concentrations in insulin dependent diabetes mellitus arises because of partial resistance at the GH receptor . ^^^ This may indicate that GHBP reflects GH receptor numbers but not necessarily post receptor events , and the weak positive correlation between GH and IGF 1 indicates that increased growth hormone secretion may compensate for reduced receptor numbers . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We studied the ontogeny of GH receptor mRNA levels and the effect of exogenous estradiol administration on GH receptor mRNA levels in rabbit liver . ^^^ A solution hybridization RNase protection assay revealed a predominant 370 base long protected band corresponding to the mRNA encoding the transmembrane GH receptor , and a 241 base long protected band , representing about 9 . 0 % , with the predicted size for the truncated form of the GH receptor . ^^^ To study the developmental profile of GH receptor expression , we studied 12 female rabbits , at ages 1 , 3 , 5 and 7 months . ^^^ Maximal GH receptor mRNA levels were observed in 3 month old animals and decreased in 7 month old animals . ^^^ Exogenous administration of estradiol , at doses that resulted in physiological circulating levels , induced a reduction in GH receptor expression , measured both by GH binding ( 36 and 46 % ) , and GH receptor mRNA levels ( 38 and 87 % ) , in animals receiving pellets containing 1 . 5 and 5 . 0 mg of estradiol , respectively . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The role of GH in regulating GH binding protein ( GHBP ) and GH receptor concentrations in humans is not clear . ^^^ In the light of these data and considering that GHBP activity in plasma probably reflects the GH receptor status in tissues , we may assume that the GH receptor was unaffected by chronic GH deficiency . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The sex linked dwarf ( dwdw ) chicken represents a valuable animal model for studying GH insensitivity and the consequence of mutations in the GH receptor ( GHR ) gene . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The levels of hepatic GH receptor mRNA and the predominant 6 . 6 kb T 3 receptor mRNA were unaffected by thyrocyte ablation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The cytoplasmic presence of this putatively plasma membrane located GH receptor is accounted for by the high receptor content of endoplasmic reticulum and the existence of a soluble form of the GH receptor , namely the GH binding protein ( BP ) derived from the membrane receptor by cleavage , and receptor localization reported here correlate well with the distribution of insulin like growth factor 1 ( IGF 1 ) mRNA and immunoreactivity in cerebellar Purkinje cells and glial cells . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The intracellular domain of the GH receptor is required for GH stimulated function . ^^^ We have therefore characterized the rat nuclear GH receptor and BP based on their distinct antigenic identity . ^^^ Cellular transfection of rat GH receptor cDNA resulted in the appearance of nuclear binding sites for 125I labeled human GH not present in the untransfected parental cell line ( Chinese hamster ovary ( CHO ) , buffalo rat liver ) . ^^^ The full length GH receptor in receptor cDNA transfected cells is nucleocytoplasmic in the absence of ligand but is also subject to rapid ligand dependent nuclear translocation . ^^^ The presence of the intracellular domain of the GH receptor in the nucleus allows the possibility of a direct nuclear response to GH . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Based on its immunochemical and ligand binding characteristics , it does not appear to be a truncated GH receptor such as the plasma GHBP . ^^^ However , it can not be excluded that the milk BP may represent a proteolytically or otherwise altered truncated form of the PRL receptor ( or , less likely , the GH receptor ) that maintains some binding activity , but has its immunological epitope ( s ) disabled . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The molecular basis that accounts for this insensitivity could comprise decreased GH receptor expression in the target organs for GH or binding of GH in the circulation to substances that compete with the receptor . ^^^ To address this hypothesis , the abundance of hepatic GH receptor mRNA was measured by solution hybridization RNase protection assay in uremic female Sprague Dawley rats , following two stage 5 / 6 nephrectomy , and in pair fed and in ad libitum fed sham operated controls ; rat GH binding protein ( GHBP ) plasma concentration was measured by a sensitive direct RIA . ^^^ Uremia was associated with a 50 % decrease of hepatic GH receptor expression compared to pair fed controls , which themselves showed a 25 % reduction of hepatic GH receptor mRNA abundance when compared to ad libitum fed controls . ^^^ Subcutaneous rhGH injections did not significantly alter the hepatic GH receptor transcript abundance or plasma GHBP levels in any of the groups . ( ABSTRACT TRUNCATED AT 250 WORDS ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Treatment of IM 9 cells with human growth hormone ( GH ) promotes rapid disulfide linkage of the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
While the GH receptor ( GHR ) plays a key role during adult life , its role during fetal development is not well understood . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In order to identify functional domains in the intracellular region of the GH receptor we generated a number of GH receptor mutants and analyzed their function after transfection into various cell lines . ^^^ A truncated GH receptor missing 184 amino acids at the C terminus was unable to mediate GH effects on transcription of the Spi 2 . 1 and insulin genes . ^^^ Furthermore , this mutant GH receptor internalized rapidly following GH binding . ^^^ Another truncated GH receptor lacking all but five amino acids of the cytoplasmic domain could not mediate any effects of GH nor did it internalize . ^^^ Deletion of the proline rich region or changing the four prolines to alanines also resulted in a GH receptor deficient in signaling . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Stoichiometry of the pulsating growth hormone ( GH ) binding to the GH binding protein and the turnover GH receptor . ^^^ The pulsatile pattern of growth hormone ( GH ) secretion is synchronized with the GH receptor ( GHR ) turnover and the ensuing GH binding protein ( GHBP ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The liver GH receptor ( GHR ) mRNA level was significantly increased after 1 day ( but not after 5 days ) of bovine GH ( bGH ) treatment in fed rats . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In order to identify the GH target cells in rat pituitary , the cellular distributions of rat GH receptor binding protein messenger ribonucleic acid ( rGH RBP mRNA ) and protein were investigated at the electronmicroscopic level , using in situ hybridization and immunocytology , respectively , on ultrathin frozen sections of rat pituitary . ^^^ Radioiodinated GH was uptaken 30 min after injection by the same three pituitary cell types , showing evidence for the functional role of the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Enzyme linked immunosorbent assay provided further evidence to indicate that 2A6 bound to GH binding protein , i . e . the soluble GH receptor , and pGH prevented this interaction in a dose dependent manner . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH effect was specific and exhibited a biphasic pattern , presumably reflecting GH receptor dimerization , typical of some other GH actions . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptor mRNA is decreased ( rat ) and the serum concentration of GH binding protein ( BP ) activity is low ( man ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Studies on the renal kinetics of growth hormone ( GH ) and on the GH receptor and related effects in animals . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Nuclear translocation of 125I hGH was also studied by isolation of nuclei from cells stably transfected with cDNAs encoding the GH receptor , GH binding protein , and a membrane bound but cytoplasmic domain deficient receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) has recently been shown to activate the GH receptor ( GHR ) associated tyrosine kinase JAK 2 . ^^^ Growth hormone ( GH ) has recently been shown to activate the GH receptor ( GHR ) associated tyrosine kinase JAK 2 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We hypothesized that glucocorticoid induced GH insensitivity is due to decreased gene expression of the GH receptor at the messenger RNA ( mRNA ) level . ^^^ To test this hypothesis , we treated 4 . 5 wk old male rabbits ( n = 6 9 per group ) with ip dexamethasone or vehicle and measured GH receptor mRNA levels ( by RNase protection assay ) and serum GH binding protein levels ( by radioimmunoprecipitation assay ) . ^^^ Contrary to our hypothesis , dexamethasone administered in growth suppressing doses did not decrease GH receptor mRNA levels in liver or growth plate . ^^^ Instead a tissue specific stimulation of GH receptor mRNA levels was observed . ^^^ The dose response relationship of this effect was biphasic , since the lower growth suppressing dose of dexamethasone ( 0 . 1 mg / kg . day ) caused the greater increase in GH receptor mRNA levels , whereas the higher growth suppressing dose ( 4 mg / kg . day ) had less effect . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH receptor ( GHR ) plays a key role in postnatal growth regulation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) insensitivity due to primary GH receptor deficiency . ^^^ Growth hormone ( GH ) insensitivity due to primary GH receptor deficiency . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The high affinity circulating GH binding protein ( GHBP ) has the same structure as the extracellular domain of the GH receptor and may reflect the sensitivity to GH in humans . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Noncontiguous deletion of the GH receptor ( GHR ) gene has been described as a molecular defect causing Laron ' s syndrome ( LS ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Although the GH receptor has recently been cloned , it is not clear whether the diverse biological activities of human GH are transduced through a single or through several types of related receptors . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These results may indicate either normal peripheral GH receptor or normal free portion of serum GH , and may suggest that the major defect in slow growth in poorly controlled diabetes is due to the post GH receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The binding specificities of the serum GHBP , the water soluble GH binding site and the GH receptor on IM 9 lymphocytes were identical . ^^^ The binding affinities for 22 , 000 hGH and for 20 , 000 hGH of the serum GHBP were similar to the binding affinity of the water soluble GH binding site but lower than those of the cellular GH receptor . ^^^ These findings show that the characteristics of the serum GHBP are comparable to those of the water soluble GH binding site released from IM 9 cells and support the hypothesis that in man the serum GHBP is produced by proteolytic cleavage of the cellular GH receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A study of chicken GH receptor ( cGHR ) expression has revealed that the two major liver and skeletal muscle transcripts of the cGHR are developmentally expressed . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Despite the absence of hepatic GH binding activity , Southern blot analysis shows that there is no gross structural change in the gene for the GH receptor ( GHR ) in this strain of dwdw chicken . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Taken together , these results suggest the existence of different pathways for the regulation of GH receptor binding to UMR 106 . 01 cells , including a stimulatory one at the pretranslational level for DEX and an inhibitory one for ( growth ) factors present in FCS . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The extent of expression of the GH receptor ( GHR ) in human tissues is largely unknown . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
MAb 218 immunoreactivity was observed in classical prolactin target cells such as mammary gland epithelium , and this immunoreactivity was abolished by preincubation of MAb 218 with purified prolactin receptor but not by preincubation with purified GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) elicits a variety of biological activities mainly mediated by the GH receptor ( GHR ) , a transmembrane protein that , based on in vitro studies , seemed to function as a homodimer . ^^^ Growth hormone ( GH ) elicits a variety of biological activities mainly mediated by the GH receptor ( GHR ) , a transmembrane protein that , based on in vitro studies , seemed to function as a homodimer . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A high affinity growth hormone binding protein ( GHBP ) in serum is derived from the extracellular domain of the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) regulation of a rat serine protease inhibitor fusion gene in cells transfected with GH receptor cDNA . ^^^ To study this process , Buffalo rat liver ( BRL ) , rat hepatoma ( FAO ) , human hepatoma ( HepG 2 ) and Chinese hamster ovary ( CHO ) cell lines were transfected with GH receptor cDNA , and stable clones expressing GH receptor mRNA and protein were selected . ^^^ However , in all the cell lines tested , SPI gene expression was less than 0 . 2 % of that measured in rat liver , and GH did not affect the expression of the endogenous SPI gene in GH receptor expressing cells . ^^^ Transient transfection of this reporter gene resulted in GH stimulation of CAT activity in all GH receptor transfected cell lines . ^^^ A 33 fold induction was measured in the GH receptor expressing BRL cells . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
OBJECTIVE : The high affinity growth hormone ( GH ) binding protein corresponds to the extracellular domain of GH receptor . ^^^ The direct role of sex steroids in pubertal bone growth may be an increased GH receptor coupled GH action . ^^^ MEASUREMENT : GHBP activity was measured by immunoprecipitation using anti GH receptor monoclonal antibody . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The functional properties of the growth hormone ( GH ) receptor was studied using cellular transfection of GH receptor cDNA . ^^^ GH treatment ( 1 . 5 2 h ) of Chinese hamster ovary cells , stably transfected with GH receptor cDNA ( CHO 4 ) , resulted in increased cellular lipid synthesis ( 240 % of control ) . ^^^ The GH receptor in CHO 4 cells was also shown to be functional in terms of ligand internalization . ^^^ A GH receptor mutant , in which 183 amino acids had been deleted in the carboxyterminal of the intracellular domain was functionally active , while a receptor without its intracellular domain was shown to be inactive . ^^^ This suggests that an approach using GH receptor cDNA transfected cells can be of value in understanding the mechanism of GH action . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Laron type dwarfism is an autosomal recessive disorder characterised by extreme growth retardation and growth hormone ( GH ) resistance and has been shown in some cases to be associated with mutations in the GH receptor gene . ^^^ However it is not known whether the GH receptor and / or the serum GH binding protein are expressed in this condition . ^^^ Using the techniques of immunohistochemistry and Northern blotting we have demonstrated that in cultured skin fibroblasts derived from four patients with Laron type dwarfism the GH receptor gene is transcribed and the GH receptor protein is expressed on the cell surface . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A mathematical model for appraisal of the impact of GH binding protein on GH receptor binding . ^^^ The competition of GH BP with the GH receptor towards GH receptor binding can have a role in these discrepancies . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Based on these predictions , we have investigated whether GH induced receptor dimerization plays a role in two classical effects of GH , i . e . stimulation of lipogenesis in primary rat adipocytes and GH receptor down regulation in cultured human IM 9 lymphocytes . ^^^ Model predictions of biological responses linked to dimer formation yielded a bell shaped pattern , with self antagonism at high GH concentrations when monomeric GH receptor complexes become predominant . ^^^ In contrast , a human GH analog ( G120R ) , mutated in the second binding surface of the hormone and , therefore , unable to induce GH receptor dimerization , failed to induce receptor down regulation in the IM 9 cells . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These two regions have been reported to form binding site 2 in hGH , which is involved in in vitro dimerization of the GH receptor ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Plasma growth hormone ( GH ) pulsatility and hepatic GH receptor characteristics were compared in experimental lines of meat type chickens selected for high ( HF ) or low ( LF ) abdominal fat content . 2 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In Laron syndrome , growth retardation is caused by GH resistance due to GH receptor ( GH R ) defects , which are associated in most cases with absent or low serum concentrations of the GH R related GH binding protein ( GHBP ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have examined the forms and the distribution of the messenger ribonucleic acids ( mRNAs ) encoding the GH receptor ( GHR ) in human digestive tissues . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Right and left ventricular ( RV and LV , respectively ) myocardial expression of GH receptor mRNA and IGF 1 mRNA were quantitated by a solution hybridization RNase protection assay . ^^^ RV GH receptor mRNA content was elevated on the fourth and seventh days after the induction of the shunt , with peak levels ( 0 . 63 + / 0 . 16 versus 0 . 14 + / 0 . 03 amol / microgram DNA for the sham operated animals ; P < . 01 ) after 4 days . ^^^ In the left ventricle , where systolic pressure was reduced in ACF rats , no differences could be detected in GH receptor and IGF 1 mRNA content between ACF and sham operated rats on any of the experimental days . ^^^ We have shown that the thin walled right ventricle responds to volume overload with an increase of GH receptor mRNA content followed by elevated expression of IGF 1 mRNA . ( ABSTRACT TRUNCATED AT 250 WORDS ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The turnover of growth hormone ( GH ) binding protein and GH receptor in rabbit and rat . ^^^ The present study was undertaken to further explore the comparative dynamics of growth hormone binding protein ( GH BP ) in relation to the turnover of the GH receptor ( GH R ) in vivo in rabbits and rats . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A monoclonal antibody to the GH receptor significantly reduced binding of 125I hGH to its receptor but had no effect on binding of 125I hGH ( L ) 108 129 . ^^^ These studies indicate that hGH ( L ) 108 129 , a sequence encompassing helix 3 of hGH , acts by binding to a site other than the GH receptor and evokes high mitogenic responses . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In order to study the relationship between gonadal steroids and GH on GHBP and GH receptor regulation , the levels of plasma GHBP , hepatic bovine GH , and human GH ( hGH ) binding as well as GHBP and GH receptor messenger RNA ( mRNA ) have now been studied in normal , Dw , hypophysectomized ( Hx ) , or ovariectomized ( Ovx ) rats , subjected to different GH and gonadal steroid exposure . ^^^ Hepatic levels of GHBP , and GH receptor mRNA transcripts showed the same trends in response to steroid or GH treatment , but the differences were rarely significant , except in Ovx animals which had higher GHBP mRNA transcripts after GH or E 2 treatment . ^^^ Thus E 2 and GH increase both plasma GHBP and hepatic GH receptor binding . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The cDNA coding for the 246 amino acid long N terminal extracellular portion of the human ( h ) GH receptor , corresponding to the circulating GH binding protein ( hGHBP ) , was cloned by polymerase chain reaction from human IM 9 lymphocytes . ^^^ The cloned hGHBP competed in a dose dependent fashion for binding of 125I labeled 22 kilodalton ( kDa ) hGH , and at higher concentrations for binding of 125I labeled 20 kDa hGH , to IM 9 lymphocytes . hGHBP decreased the association rate of [ 125I ] hGH to the cells without decreasing the dissociation rate . hGHBP blocked the down regulation of GH receptor in IM 9 cells by both 22 and 20 kDa hGH . hGHBP also blocked the binding of [ 125I ] hGH to PRL receptors on Nb 2 lymphoma cells and the effect of the hormone on thymidine incorporation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Northern blot analysis of ES cells using a probe corresponding to the extracellular domain of the GH receptor demonstrated the presence of two transcripts ( 1 . 2 and 4 . 5 kilobases ) . ^^^ The RNAse protection solution hybridization assay revealed that ES cells express approximately one sixth of the GH receptor messenger RNA ( mRNA ) levels expressed in liver from pregnant mice . ^^^ Treatment of cultured ES cells with retinoic acid ( 100 nM ) for 6 days increased GH receptor mRNA levels ( P < 0 . 01 ) . ^^^ GH receptor mRNA was further identified in ES cells , preimplantation embryos , muscle , liver , and placenta by a reverse transcription / polymerase chain reaction assay . ^^^ In humans it has previously been shown that exon 3 of the GH receptor is deleted in the placenta . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
It is suggested that changes in GH secretion dynamics secondarily lead to most of the changes in GH receptor abundance and GH binding protein ( GH BP ) abundance . ^^^ It is suggested that these conditions regulate primarily the pattern of GH pulsatility , which in turn regulates the GH receptor / GH BP , and thereby exert the specific effects on target cells to promote or suppress growth or to express distinct metabolic actions . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Because no line difference in plasma GH concentrations was found in adult hens , other unknown mechanisms probably play a role in determining differences in GH receptor binding between these selected lines at older ages . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Recently much has been learnt about the molecular structure of GH receptor , its binding to ligand , and the ensuing signal transduction events . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To determine whether this GH resistance is manifest at the level of the hepatic GH receptor or in the ability of GH to initiate IGF 1 gene expression , we have determined hepatic IGF 1 mRNA expression , circulating IGF 1 and hepatic GH binding during various stages of pregnancy and lactation in the rat . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In rodents the GH receptor gene encodes long and short isoforms of the receptor that arise from alternate splicing of the mRNA transcript . ^^^ The abundance of RNA transcripts that encode the long and short isoforms of the GH receptor remained unchanged when adipocytes were incubated in vitro for 3 h in the presence or absence of actinomycin D . ^^^ Therefore , the acute changes seen in these experiments do not reflect regulation of GH receptor gene transcription . ^^^ Adipocytes appear to maintain a fixed ratio of the long and short isoforms of the GH receptor on their surface . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
It is concluded that the findings described are compatible with a normal GH receptor and normal signal transmission for IGFBP 3 synthesis but a defect exists in the post GH receptor mechanism for the generation of IGF 1 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Serum GH binding protein ( GH BP ) , which is identical with the extracellular domain of the GH receptor , has important implications for the distribution and physiological activity of GH and may enable evaluation of GH receptor function . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Spi 2 . 1 , Spi 2 . 2 , Spi 2 . 3 , insulin like growth factors ( IGF ) 1 and 2 , and GH receptor mRNAs were measured in rat liver total RNA from gestational days 19 , 20 , 21 , and postnatal day 2 . ^^^ Low levels of GH receptor mRNAs ( approximately 10 % of adult ) were present on all measured days . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Human blood contains a high affinity GH binding protein ( GHBP ) which corresponds to the extracellular domain of he GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To obtain an animal model for studying the role of the GH receptor ( GHR ) in growth and development , we analyzed a sex linked dwarf ( SLD ) chicken strain ( Leghorn ) which exhibits phenotype similarities with a human genetic growth disorder , an autosomal recessive GH resistance condition ( Laron dwarfism ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In situ hybridization revealed the presence of mRNA coding for GH receptor in calvaria cells . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The mRNA levels were quantitated by ribonuclease protection assay , using probes specific for mRNA encoding , extracellular and intracellular domains of the GH receptor , and short and long forms of the PRL receptor , respectively . ^^^ Specific transcripts for the GH receptor were present in pancreas , islets , and RIN 5AH cells . ^^^ Dexamethasone induced a 2 . 5 fold increase in GH receptor mRNA levels , and a weak stimulatory effect was also observed for progesterone . ^^^ In RIN 5AH cells , the effect of dexamethasone on GH receptor mRNA was detectable after 2 h and maximal after 16 h . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH receptor ( GHR ) in regenerating rat liver following partial hepatectomy has been characterized in terms of mRNA levels , size of receptor variants , ligand binding , endocytosis and degradation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To test this hypothesis further , a Western blotting assay employing antibodies to phosphotyrosine was used to determine whether proteins other than the GH receptor might serve as substrates of the GH receptor associated tyrosine kinase . ^^^ The ability of inhibitors of the GH receptor associated kinase to block actions of GH was also investigated . ^^^ Staurosporine , herbimycin A , and tyrphostin were identified as inhibitors of the GH receptor associated kinase . ^^^ When added to anti GH antibody immunoprecipitates from GH treated cells , they inhibited incorporation of 32P from [ gamma 32P ] ATP into tyrosyl residues in GH receptor complexes . ^^^ Inhibitors of the GH receptor associated tyrosine kinase also abolished GH dependent activation of microtubule associated protein ( MAP ) kinase . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have constructed a series of truncations of the cytoplasmic domain of the human GH receptor and have examined the function of these truncated receptors by expressing them in the interleukin 3 dependent promyeloid cell line , FDC P 1 . ^^^ When transfected with a functional GH receptor , these cells grow in the presence of GH without interleukin 3 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptor immunoreactivity is widely distributed within the rat pituitary gland , although apart from somatotrophs the cell types with GH receptor immunoreactivity have yet to be identified . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We report here the location of the GH receptor in the brain of the rat and rabbit . ^^^ Receptor distribution was determined by immunohistochemistry with GH receptor / binding protein ( BP ) specific monoclonal antibodies and by in situ hybridization with a [ 35S ] riboprobe . ^^^ GH receptor / BP immunoreactivity in the rat was most prominent in the neonate and declined with postnatal age . ^^^ A similar distribution of GH receptor mRNA was seen by in situ hybridization . ^^^ The ontogeny of GH receptor / BP mRNA in whole rat brain was quantified by solution hybridization RNAse protection assay . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
All of these substances are more than 50 fold reduced in binding to the GH receptor , yet can bind and activate lactogenic receptors . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Based on this novel finding , we conclude that decreased GH receptor density may explain reduced growth velocity despite increased secretion of GH in some IDDM children . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
By complementary DNA cloning we have identified two amino acid substitutions in the intracellular region of the human GH receptor in a child with growth failure and clinical features of the Laron syndrome . ^^^ Direct analysis of exon 10 of the GH receptor gene showed that both nucleotide substitutions reside on the same chromosome and were inherited from the patient ' s mother . ^^^ These observations represent the first demonstration of variation within the intracytoplasmic part of the human GH receptor and indicate that mutations occurring at multiple locations within the receptor gene may lead to the same clinical phenotype . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Previous work in multiple cell types has shown that endogenous GH receptors , as well as the cloned liver GH receptor , associate with a tyrosine kinase . ^^^ However , in SDS PAGE gels of highly purified , kinase active GH receptor preparations from 35S labeled 3T3 F442A cells , only one broad band was detected corresponding to the molecular weight of the GH receptor rather than two bands which might be expected to result from a kinase receptor heterocomplex . ^^^ In the present study , a transfected Chinese hamster ovary ( CHO ) cell line ( CHO 4 ) that expresses an 84 kDa GH receptor rather than a 121 kDa GH receptor was used to examine whether the GH receptor might form a complex with a protein ( e . g . tyrosine kinase ) that comigrates on SDS polyacrylamide gel electrophoresis gels with the endogenous GH receptor ( M ( r ) 121 , 000 ) in 3T3 F442A cells . ^^^ GH GH receptor complexes were immunoprecipitated with anti GH antibody from GH treated CHO 4 cells and incubated with [ gamma 32P ] ATP . 32P was incorporated into a 121 kDa protein as well as the 84 kDa GH receptor . ^^^ Phosphorylation of both the 84 kDa GH receptor and the 121 kDa protein was on tyrosyl residues as determined by Western blotting with anti phosphotyrosine antibody . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The separation of bound from free GH by immunoprecipitation using a monoclonal antibody to the GH receptor may be a more practical alternative . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
As the GH receptor binds oPL with higher potency than oGH , the parallel ontogenic changes in [ 125 ] oGH and [ 125 ] oPL binding in the liver do not support the presence of a PL receptor under independent developmental regulation . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The mutation was introduced by site directed mutagenesis into cDNAs encoding the full length rabbit GH receptor and the extracellular domain or binding protein ( BP ) of the human and rabbit GH receptor , and also in cDNAs encoding the full length and the extracellular domain of the related rabbit prolactin ( PRL ) receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Three d and 1 week after hypophysectomy , plasma T 3 was also markedly decreased , while T 4 was only slightly affected , hepatic 5 ' D 1 activity showed a transient decrease , but 5D 3 activity was highly increased , as were the number of hepatic GH receptor sites . ^^^ GH receptor deficient dwarf chickens had decreased plasma T 3 and increased plasma T 4 and hepatic 5 ' D 1 and 5D 3 activities compared to their normally growing siblings . ^^^ The effectiveness of exogenous GH administration to acutely increase plasma T 3 probably depends on the balance between the injected dose and the endogenous GH concentration , the hepatic GH receptor availability and the hepatic type 3 deiodinase level . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Free fatty acid responses to growth hormone ( GH ) releasing factor and the GH GH receptor axis ] . ^^^ The functional assessment of GH receptor has been previously performed by GH induced somatomedin ( SM ) generation test . ^^^ There is a specific GH receptor on adipocytes , and GH induces lipolysis with an increment of plasma free fatty acid ( FFA ) . ^^^ In this report , we examined GH and FFA responses to GRF loading tests and GH binding protein , which reflects the tissue GH receptor concentration , in 30 short children , and we evaluated the lipolysis mediated by GH and GH receptor axis . ^^^ These results suggest that FFA responses to GRF loading depend on the integrated GH secretion and tissue GH receptor content . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A significant finding was that P band is unable to bind to the pig liver membrane GH receptor in a competitive radioreceptor assay . ^^^ Consequently , our results also suggest that the C terminal portion of rPGH , including in particular the last eight amino acids , is of major importance in the binding of rPGH to the pig liver membrane GH receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
While GH has pleiotropic actions on cellular growth and metabolism , most of its effects are believed to be mediated by a single GH receptor . ^^^ GH ( 5 500 micrograms / L ) caused a profound decrease in the sensitivity of normal T lymphoblasts in response to all insulin concentrations ( P < 0 . 0001 vs . insulin alone ) ; pretreatment with GH and GH receptor antibody significantly improved sensitivity to all concentrations of insulin ( P = NS vs . insulin alone ) . ^^^ Thus , in normal T cell lines , the major pathway of GH induced insulin resistance appears to be directed by the GH receptor , with a smaller effect mediated through the PRL receptor . ^^^ GH receptor antibody did not abrogate this effect at any insulin concentration ( P = NS vs . insulin alone ) , but there was partial restoration of insulin sensitivity when GH and PRL receptor antibody were coincubated ( P = 0 . 0069 vs . insulin alone ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptor ( GHR ) mRNA has been identified in peripheral ( liver and muscle ) and central ( brain and hypothalamus ) tissues of sex linked dwarf ( SLD ) Leghorn chickens . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In 10 patients of different ethnic origins , we have analyzed all the GH receptor ( GHR ) coding exons along with their splice junctions and 6 intragenic polymorphic sites defining several GHR gene haplotypes . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Severe growth hormone insensitivity ( Laron syndrome ) due to nonsense mutation of the GH receptor in brothers from Russia . ^^^ Primary GH insensitivity ( Laron syndrome ) due to GH receptor deficiency ( GHRD ) is an autosomal recessive condition characterized by severe growth failure . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Nutrition is an important regulator of the GH receptor / binding protein . ^^^ The growth failure presented by undernourished children is associated with partial GH resistance and low GH receptor level . ^^^ On the contrary , children with obesity and normal growth have a high GH receptor level . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Northern blot analysis , using a probe recognizing exon 10 of the human GH receptor , revealed a 4 . 7 kilobase transcript corresponding to the human GH receptor . ^^^ Cultured osteoblast like cells expressed , as determined by RNase protection assay , approximately one fourth of the GH receptor messenger RNA levels found in liver . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The high affinity GH binding protein ( GHBP ) is a soluble circulating ectodomain of the GH receptor ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The sex linked dwarf ( SLD ) chicken , which lacks GH receptor ( GHR ) , and its normal littermates provide a useful experimental system to investigate GH dependent cellular responses . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
On the other hand , the PCR products corresponding in size to the mouse GH receptor were detected in mouse hemopoietic blast cells as well as liver . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Ligand dependent GH receptor dimerization was demonstrated but PRL receptor dimerization was not observed in an analogous assay , suggesting that these related growth factors may not engage receptors in a similar manner . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
No apparent change in tissue GH receptor , IGF 1 , IGF 1 receptor , IGF 2 , or IGF 2 receptor messenger ribonucleic acids occurred as a result of exercise after the 14 week pretreatment period or after treatment with rhGH or PL . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Although a high affinity binding site for oPL in ovine fetal liver has been reported , some investigators believe this to be the GH receptor . ^^^ The fact that saturable binding could not be demonstrated for either GH or PRL with fetal liver microsomes contradicts recent suggestions that oPL is binding the GH receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Therapeutic applications of recombinant human IGF 1 , currently under trial in the treatment of growth retardation resulting from GH receptor abnormalities , hypercatabolic states and would repair , may also be envisaged for cases of insulin resistance , particularly type 2 diabetes . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Pronounced expression of GH receptor / binding protein was observed with two monoclonal antibodies and lesser reactivity was seen with others , paralleling their affinities for the receptor . ^^^ The cytoplasmic presence of this putatively plasma membrane located GH receptor is accounted for by the existence of a soluble form on the GH receptor , namely the growth hormone binding protein derived from the membrane receptor by cleavage . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Binding studies revealed that G120RhGH bound preferentially to hepatic PRL receptors , as [ 125I ] G120hGH was completely displaced by ovine PRL but was unaffected by bGH , a specific GH receptor ligand . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Opposite regulation of IGF 1 and IGF 1 receptor mRNA and concomitant changes of GH receptor and IGF II / M6P receptor mRNA in human IM 9 lymphoblasts . ^^^ Antisense riboprobes for human IGF 1 , IGF 1 receptor , IGF II / M6P receptor , GH receptor and for comparison for human beta actin were synthesized and labeled with 32P . ^^^ Protected fragments of 379 bases and of 420 and 350 bases with the IGF 1 receptor and with the IGF 1 probe respectively and protected fragments of 670 bases and of 51 and 121 bases with the GH receptor and with the beta actin probe were detected . ^^^ Conversely , the expression of IGF 1 receptor mRNA and beta actin mRNA increased by more than 250 % after the withdrawal of serum within 2 and 8 h respectively , while GH receptor mRNA fell within 2 4 h . ^^^ In addition , GH receptor mRNA expression parallels IGF 1 mRNA expression . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Body growth , GH secretory pattern , hepatic GH receptor ( GHR ) , and plasma GH binding protein ( GHBP ) levels are all sexually dimorphic in the rat . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The effects of cortisol on hepatic GH receptor and insulin like growth factor 1 ( IGF 1 ) gene expression were investigated in sheep fetuses during late gestation and after experimental manipulation of plasma cortisol levels by fetal adrenalectomy and exogenous infusion of cortisol . ^^^ Hepatic GH receptor and IGF 1 messenger RNA ( mRNA ) levels increased with increasing gestational age in parallel with the normal rise in fetal cortisol levels toward term ( 145 + / 2 days ) . ^^^ When the data from all the fetuses were combined irrespective of treatment or gestational age , there were significant positive correlations between the log plasma cortisol concentration in utero and the abundance of GH receptor and IGF 1 mRNA in the fetal liver . ^^^ These findings show that cortisol is a physiological regulator of hepatic GH receptor and IGF 1 gene expression in fetal sheep during late gestation and indicate that it preferentially increases the class 2 transcript of the IGF 1 gene . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
While mRNA transcripts for IGF 1 , GH receptor , and IGFBP 2 , 3 , 4 , and 5 were readily detectable in ovarian tissue , GRFi had no effect on ovarian levels of mRNA for each of these proteins . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We argued that if GH were to act directly on NPY neurons , NPY neurons should express the GH receptor ( GHR ) gene . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The proline rich region of the GH receptor is essential for JAK 2 phosphorylation , activation of cell proliferation , and gene transcription . ^^^ Mutational analysis of the proximal transmembrane region of the cytoplasmic domain of the GH receptor ( GHR ) allowed us to characterize box 1 , a proline rich sequence of eight amino acids , which has been shown to be critical for signal transduction of many cytokine receptors . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The mechanisms linking the GH receptor to these signals have not been fully identified . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The mechanisms that account for this insensitivity include reduced hepatic GH receptor expression , decreased production of IGF 1 , and inhibition of IGF bioactivity by increased binding of IGFs to their specific binding proteins . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In the male rat , few GHRH containing neurons in the arcuate nucleus ( ARC ) appear to express the GH receptor messenger RNA ( mRNA ) ; however , some unidentified neurons near GHRH neurons do . ^^^ First , we performed double label in situ hybridization to determine whether NPY neurons in the ARC express GH receptor mRNA . ^^^ We found that most of the NPY containing neurons in the ARC expressed GH receptor mRNA , whereas hypothalamic NPY neurons residing outside of the ARC did not . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Laron syndrome ( LS ) is a severe autosomal recessive form of GH resistance resulting from molecular defects in the GH receptor ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) and a GH antagonist promote GH receptor dimerization and internalization . ^^^ In this study , we report the ability of hGH and hGH G120R to be internalized by GH receptor expressing cells . ^^^ The predominant radiolabeled band detected was a complex of approximately 140 kDa which probably represents one GH molecule bound to one GH receptor . ^^^ Growth hormone ( GH ) and a GH antagonist promote GH receptor dimerization and internalization . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) status regulates GH receptor and GH binding protein mRNA in a tissue and transcript specific manner but has no effect on insulin like growth factor 1 receptor mRNA in the rat . ^^^ The effect of growth hormone deficiency ( GHD ) and treatment with recombinant bovine GH ( bGH ) or human IGF 1 ( hIGF 1 ) for 10 days on the expression of GH receptor ( GHR ) , GH binding protein ( GHBP ) and of insulin like growth factor 1 receptor ( IGF IR ) mRNA was examined using dw / dw and normal Lewis rats . ^^^ Growth hormone ( GH ) status regulates GH receptor and GH binding protein mRNA in a tissue and transcript specific manner but has no effect on insulin like growth factor 1 receptor mRNA in the rat . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The binding of growth hormone ( GH ) to its receptor results in its dimerization followed by activation of Jak 2 kinase and tyrosine phosphorylation of the GH receptor itself , as well as Jak 2 and the transcription factors Stat 1 , 3 , and 5 . ^^^ In order to study the role of GH receptor tyrosine phosphorylation in intracellular signaling , we constructed GH receptors in which combinations of tyrosines were mutated to phenylalanines . ^^^ Any of these three tyrosines is able to independently mediate GH induced transcription , indicating redundancy in this part of the GH receptor . ^^^ Tyrosine phosphorylation was not required for GH stimulation of mitogen activated protein ( MAP ) kinase activity or for GH stimulated Ca2+ channel activation since these pathways were normal in cells expressing a GH receptor in which all eight intracellular tyrosines were mutated to phenylalanines . ^^^ Activation of Stat 5 by GH was , however , abolished in cells expressing the GH receptor lacking intracellular tyrosines . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The fourth helix ( helix 4 ) in the human growth hormone ( hGH ) molecule plays a role in binding to the GH receptor as well as the PRL receptor through topologically different amino acids . ^^^ When these results were compared with those reported for binding of hGH to its receptors , the binding of PRL to the PRL receptor was shown to involve amino acids topologically similar to those in the binding of hGH to the PRL receptor , rather than those in the binding of hGH to the GH receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Hormonal regulation of the female enriched GH receptor / binding protein mRNA in rat liver . ^^^ At least two classes of mRNA for the GH receptor ( GHR ) and GH binding protein ( GH BP ) with different 5 ' untranslated first exons exist in the rat . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The growth hormone ( GH ) independent growth of the obese Zucker rat is not due to increased levels of GH receptor messenger RNA in the liver . ^^^ To assess whether the liver expression of the GH receptor ( GHR ) messenger RNA ( mRNA ) is increased and / or if the liver expression of IGFBP 3 mRNA is maintained in the obese , Zucker rats of both genders and phenotypes ( four groups , n = 6 / group ) were studied at 12 weeks of age . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Ontogeny of GH receptor and GH binding protein in the pig . ^^^ The present study was undertaken to examine the developmental pattern of GH receptor ( GHR ) and GHR gene expression in skeletal muscle ( longissimus dorsi and trapezius ( TR ) ) and liver from the last third of gestation until 1 year of age in male Large White ( LW ) and Meishan ( MS ) pigs . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The effects of octreotide on GH receptor and IGF 1 expression in the GH deficient rat . ^^^ This study aimed to determine whether such effects were mediated via the GH receptor ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Males had a higher growth rate than females regardless of the imposed lighting schedule and this pronounced growth difference is reflected by higher plasma concentrations of growth hormone ( GH ) , and a better GH receptor occupancy . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Laron syndrome is the most severe form of GH insensitivity , arising from an absent or defective GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Conclusions are that GH and PRL are stimulatory to progesterone secretion by LLC ( location of GH receptor ) and SLC are responsive to LH during mid pregnancy . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Western blotting indicates that GH also activates STAT 5 in human embryonic kidney cells ( 293 ) , which stably express the rabbit GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH has been shown to activate the GH receptor ( GHR ) associated tyrosine kinase JAK 2 and the Src homology 2 domain containing transcription factors Stats ( signal transducers and activators of transcription ) 1 , 3 , and 5 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Nodular tumors of the skin , identified as highly malignant Ki 1 lymphomas of large anaplastic cells , had intense GH receptor immunoreactivity . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptor ( GHR ) expression differs during development between central and peripheral tissues . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In rabbits and probably in man , GH binding protein ( GHBP ) is generated from proteolysis of GH receptor ( GHR ) . ^^^ The present study describes the modulation of spontaneous release of GHBP into the culture medium in relation to cellular GH receptor ( GHR ) in Chinese hamster ovary cells transfected with rabbit GHR complementary DNA . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In search of the cellular site of growth hormone ( GH ) binding protein cleavage from the rabbit GH receptor . ^^^ Transfection of Chinese hamster ovary cells with rabbit GH receptor ( GHR ) complementary DNA resulted in high expression of cellular GHR as well as markedly time and temperature dependent secretion of soluble GH binding protein ( GHBP ) into the culture medium . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Both GH and the GH receptor have been reported to undergo rapid nuclear translocation . ^^^ Janus kinases ( JAK ) 1 and 2 have been implicated in GH receptor signaling , and both of these kinases are phosphorylated by GH stimulation . ^^^ Both JAK 1 and JAK 2 exhibit a nucleocytoplasmic distribution by immunocytochemistry in unstimulated serum deprived CHO cells stably transfected with rat GH receptor complementary DNA ( cDNA ) . ^^^ The nucleocytoplasmic localization of JAK 2 was verified by immunogold electron microscopy in both rat liver hepatocytes and CHO cells stably transfected with rat GH receptor cDNA . ^^^ No change in the nuclear content of JAK 1 or JAK 2 was observed upon ligand stimulation of GH receptor cDNA transfected cells with 100 nM human GH for 5 , 10 , 15 , 30 , or 60 min . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In non insulin dependent diabetes mellitus ( NIDDM ) , data are limited , and the regulation of the GH receptor ( GHR ) remains unclear . ^^^ Low GHBP levels may reflect a reduced GH receptor density and a concomitant GH insensitivity , which leads to an impaired IGF generation in insulin deficient patients . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The reduction in specific growth hormone binding protein ( GHBP ) , corresponding to the extracellular domain of the GH receptor , provides an indirect indication of the hepatic density of GH receptors , as does the reduction in IGFBP 3 , the major IGF binding protein , which is GH dependent . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Laron syndrome , the prototype for GH insensitivity , is most often due to GH receptor deficiency . ^^^ Recent data have indicated that partial GH receptor deficiency could be involved in children with apparently idiopathic short stature . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH binding protein ( GHBP ) is decreased , which may reflect decreased GH receptor activity . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GHBP is a soluble , circulating ectodomain of the GH receptor ( GHR ) ; its plasma level is thought to reflect GHR levels in tissues and , hence , GH responsivity . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Furthermore , in COS 7 cells transiently transfected with STAT 5 and GH receptor cDNAs , it was found that expression of STAT 5 was necessary for GH induction of these two DNA binding complexes . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Eight children with GH insensitivity syndrome , five with GH receptor deficiency ( Laron syndrome ) and three with growth attenuating antibodies to GH , were treated with recombinant human insulin like growth factor 1 ( IGF 1 ) for 24 months ( one was treated for 36 months ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The distribution of the GH receptor was investigated to explain the zonal effects of GH . ^^^ Immunohistochemically , a moderate perivenous dominance was observed , whereas the mRNA abundance of both GH receptor and GH binding protein was slightly higher in the periportal region . ^^^ Thus , zonal regulation by GH does not appear to result from a GH receptor zonation ; rather , a sinusoidal GH gradient may be involved . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This suggests a common pathway for IGF 1 and GH enhancing protein anabolism in the normally fed state . rhIGF 1 also stimulates linear growth in children with defects in the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Plasma GH binding protein ( GHBP , the circulating ectodomain of the GH receptor ) levels are decreased in patients with renal failure , as are hepatic GH receptor levels in animal models . ^^^ Since GHBP levels are thought to reflect GH receptor levels in tissues , it is likely that the uremic GH insensitivity in humans is mediated by a decreased number of GH receptors . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To study the role of thyroid hormone in the expression of the GH receptor ( GHR ) and GH binding protein ( GHBP ) gene , we examined the serum and liver tissue of female and male hypothyroid ( thyroidectomized ) , thyroxine treated thyroidectomized and euthyroid control rats . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH induces the expression of the immediate early gene c fos in the ARC ; however , few GHRH residing in the ARC express the GH receptor , suggesting that the action of GH on GHRH cells must be indirect through another population of unidentified cells . ^^^ NPY neurones express c fos in response to GH , and preliminary results suggest that NPY neurones in the ARC express the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Displacement studies on hepatic microsomes indicate that this preparation does not compete with radiolabeled chicken growth hormone ( cGH ) for hepatic GH receptor binding . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This hepatic insensitivity to the action of GH is partially owing to a reduced GH receptor expression . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Next , because of the reduced GH receptor binding noted above and the reported decrease in epidermal growth factor ( EGF ) expression in ATN , we tested the thesis that the low kidney IGF 1 mRNA levels in ATN are partly due to a relative or absolute deficiency of these hormones . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In rats with PAN nephropathy , administration of rhIGF 1 increased IGF 1 and GH receptor gene expression , without altering the steady state level of IGF 1 receptor mRNA . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The osteoblast like rat osteosarcoma cell line UMR 106 . 01 , in which GH acts as a mitogen via a high affinity GH receptor , was used as a model for GH induced protein phosphorylation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We did not detect GH receptor mRNA in glomeruli . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH receptor ( GHR ) is a member of the cytokine receptor superfamily ; its signaling involves the activation of Janus tyrosine kinases ( JAK 2 ) and Stat ( signal transducers and activators of transcription ) transcription factors . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Peripheral GH resistance due to changes at the level of the GH receptor has been suggested as one of the most probable explanation . ^^^ The decreased GHBP levels observed in this group of children with ISS suggest that they may present a certain degree of GH insensitivity , probably due to a defect at the GH receptor level . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Among children with ISS , we have identified a subgroup where defects at the level of the GH receptor lead to a partial GHI syndrome ( Carlsson et al , 1994 ; Attie et al , 1995 ; Goddard et al , 1995 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Portal levels of insulin are critical for the integrity of the hepatic GH receptor and suppression of the inhibitory IGF binding protein 1 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The effects of growth hormone ( GH ) and dietary protein on expression of IGF 1 and GH receptor ( GHR ) genes in liver , muscle , and fat of pigs were investigated . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Decreased muscle cell proliferation in chicks with a deletion in the GH receptor gene . ^^^ Sex linked dwarfism in the chick is caused by mutation or deletion in the GH receptor gene and has provided a useful model to study the physiological consequences of GH insensitivity . ^^^ This study determined the consequences of GH receptor gene mutation on muscle cell proliferation in vivo . ^^^ Northern and Southern blotting and PCR analysis revealed restriction fragment length polymorphism patterns and a 1 . 7 kb deletion of the intracellular domain of the GH receptor gene in commercial dwarf broiler chicks , similar to the Connecticut strain in which there is a dysfunctional GH receptor . ^^^ The absence of a functional GH receptor in the dwarf is associated with a greater decline in DNA synthesis and suggests that GH may directly affect a proportion of cells , since there was no difference in IGF 1 mRNA or peptide . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Briefly , binding of GH to GH receptor induces receptor dimerization and activation of the tyrosine kinase JAK 2 . ^^^ Tyrosyl phosphorylation of GH receptor and JAK 2 recruits and activates signaling molecules such as Stat transcription factors , SHC , and insulin receptor substrates 1 and 2 that lead to the release of second messengers such as diacylglycerol , calcium , and nitric oxide and the activation of enzymes such as mitogen activated protein kinase , protein kinase C , phospholipase A 2 , and phosphatidylinositol 3 ' kinase . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Mouse osteoblasts express GH receptor mRNA with gene transcripts of 4 . 2 and 1 . 2 kb , at levels which reach approximately 1 / 6 of those in mouse liver and 1 / 3 of those in mouse muscle . ^^^ Two populations of undifferentiated and diffentiated osteoblasts , obtained by sequential collagenase digestion of mouse calvaria , were used to study the relationship between osteoblastic phenotype and GH receptor expression . ^^^ Together , these data demonstrate the presence of a high affinity GH receptor in mouse osteoblasts which is related to differentiation . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The objectives were to isolate cDNA for the GH receptor within the reproductive tissues of cattle and to examine these cDNA as potential variants of the GH receptor that bind PL . ^^^ Ten cDNA clones were isolated from a bovine endometrial cDNA library with a 32P labeled cDNA of the GH receptor extracellular domain . ^^^ The exon 1 DNA sequence of each clone ( exon 1B ) was different from the previously reported exon 1 for the bovine GH receptor cDNA isolated from liver ( exon 1A ) . ^^^ Analyses of these cDNA sequences showed that exon 1B contained significant homology with placental forms of the GH receptor found in mouse and human . ^^^ Amplification of GH receptor mRNA by reverse transcriptase polymerase chain reaction , with exon 1A and 1B specific forward primers , showed that exon 1B was expressed in liver , corpus luteum , ovary , endometrium , and myometrium . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The objectives of Experiment 1 were to determine mRNA expression for GH receptor ( GHR ) and LH receptor ( LHR ) in porcine luteal tissues during the estrous cycle and pregnancy and to relate changes in these receptor mRNA with changes in steroidogenic enzyme mRNA for cytochrome P 450 side chain cleavage enzyme ( P450sec ) and 3 beta hydroxysteroid dehydrogenase ( 3 beta HSD ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The role of growth hormone ( GH ) , GH receptor and GH binding protein in reproduction and ovulation induction . ^^^ The recently described GH binding protein ( BP ) may reflect the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This dual action of GC on GH secretion is probably due to the fact that they act at different loci ; i . e . in the regulation of GH transcription and GHRH and somatostatin receptors at the pituitary level as well as GHRH , somatostatin and GH receptor gene expression at the hypothalamic level . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A variety of mechanisms including decreased GH receptor binding , post receptor resistance to GH , and reduced steady state mRNA for IGF 1 contribute to this decrease . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Based on these results , it is likely that most of the actions of human GH in the liver are mediated by the GH receptor rather than by the PRL receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Differential effects of maternal ovine placental lactogen and growth hormone ( GH ) administration on GH receptor , insulin like growth factor ( IGF ) 1 and IGF binding protein 3 gene expression in the pregnant and fetal sheep . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Recent data suggest involvement of the Janus tyrosine kinase 2 ( JAK 2 ) in human GH induced tyrosine phosphorylation of the GH receptor and the insulin receptor substrates 1 and 2 ( IRS 1 and IRS 2 ) , leading to activation of the phosphatidylinositol 3 kinase and the acute insulin like effects in primary rat adipocytes . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
It is substantially less clear that GH acts directly on skeletal muscle to stimulate its growth ; the presence of GH receptor mRNA in skeletal muscle is well established , but most investigators have been unsuccessful in demonstrating any specific binding of GH to skeletal muscle or to myoblasts in culture . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Messenger RNA for GH receptor , IGF 1 , IGFBP 2 , IGFBP 3 , and actin were measured by nuclease protection assays . ^^^ The CL contained more GH receptor mRNA than the other reproductive tissues examined . ^^^ The GH receptor mRNA was decreased in cows treated with GH whereas the mRNA for IGF 1 , IGFBP 2 , or IGFBP 3 was not changed . ^^^ In summary , the level of mRNA encoding GH receptor , IGF 1 , IGFBP 2 , and IGFBP 3 varied within the tissues examined , suggesting that these genes may play a variety of roles in the bovine female reproductive tract . ^^^ Supplemental GH failed to change the expression of IGF 1 , IGFBP 2 , and IGFBP 3 mRNA , possibly because of low GH receptor mRNA levels in tissues other than CL . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Characterization of the mechanism of signaling utilized by GH indicated that tyrosine residues in GH receptor are not necessary for tyrosyl phosphorylation of IRS 2 ; however , the regions of GH receptor necessary for IRS 2 tyrosyl phosphorylation are the same as those required for JAK 2 association and tyrosyl phosphorylation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH stimulates the healing of colonic anastomoses either directly or through insulin like growth factor 1 ( IGF 1 ) since specific GH receptor as well as IGF 1 receptor have been demonstrated in colon . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH induced activation of JAK 2 , a GH receptor ( GHR ) associated tyrosine kinase , leads to tyrosine phosphorylation and activation of STATs ( signal transducers and activators of transcription ) 1 , 3 , and 5 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To address this issue , we first studied the GH receptor mRNA content in both the periventricular and arcuate nuclei of the hypothalamus after dexamethasone treatment . ^^^ We found a significant decrease in GH receptor mRNA levels in the periventricular nucleus and in the arcuate nucleus after 1 , 3 , 8 , and 15 days of glucocorticoid administration . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The effects of recombinant bovine GH treatment on milk production and on the regulation of GHBP and hepatic GH receptor levels were studied . ^^^ The GH receptor gene expression , analyzed by slot blot and hybridization with an [ alpha 32P ] GH receptor cDNA probe , was not modified by the GH treatment . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This state may be reflected by the reduction of the circulating GH binding protein ( GHBP ) , corresponding to the extracellular domain of the GH receptor , and the reduction of insulin like growth factor binding protein ( IGFBP ) 3 , major IGF 1 binding protein , upregulated by GH . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Finally , experiments performed with cells expressing wild type , truncated , or mutated forms of the GH receptor indicate that protein kinase Janus kinase 2 is involved in the GH dependent activation of the spi GAGA box . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH receptor ( GHR ) is a protein of 620 amino acids ; the extracellular domain of 246 amino acids is made of two subdomains , one being the domain of interaction with the ligand , the second one being the region of association with another receptor resulting in a homodimer . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH binding protein ( GHBP ) is the extracellular portion of the GH receptor . ^^^ Its concentrations in circulation are decreased in severe malnutrition , reflecting a decrease in tissue GH receptor abundance . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The increase in IGF 1 in response to T treatment despite a moderate decline in GHBP ( and possibly GH receptor ) levels is most likely due to the large increase in GH , which may override a modest decrease in GHBP / GH receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Human skin fibroblasts as a model of growth hormone ( GH ) action in GH receptor positive Laron ' s syndrome . ^^^ Congenital GH insensitivity ( Laron ' s syndrome , LS ) is often associated with a dysfunctional GH receptor ( GHR ) causing complete insensitivity to GH and absent serum GH binding protein ( GHBP ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The physiological role of the non 22 K GH isoforms is poorly understood , but they may represent a spectrum of agonists or antagonists of the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The circulating high affinity GH binding protein ( GHBP ) , which derives from the extracellular domain of the hepatic GH receptor , correlates inversely to GH levels and directly to body mass index ( BMI ) in healthy adults . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These derangements include partial GH receptor deficiency , increased plasma binding of IGF 1 , and accumulation of non competitive inhibitors of IGF 1 action . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Studies of GH receptor ( GHR ) gene expression in human tissues have been hampered by the limited amount of tissue available for analysis and the low sensitivity of conventional methods . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH receptor ( GHR ) is a member of the cytokine receptor superfamily ; GH binding protein is the solubilized extracellular domain of the GHR . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have characterized the GH receptor mutation that is responsible for extreme short stature and GH insensitivity in a Bahamian genetic isolate . ^^^ The predicted protein lacks 21 amino acids , including those defining the WS like motif of the GH receptor extracellular domain . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have reported 1 yr results of a double blind , placebo controlled trial of recombinant human insulin like growth factor 1 ( rhIGF 1 ) replacement in 16 children from the Ecuadorian GH receptor deficient ( GHRD ) population . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
As many of the acute inflammatory responses in critical illness are mediated by the proinflammatory cytokines interleukin 1 beta ( IL 1 beta ) and tumor necrosis factor alpha ( TNF alpha ) , the present studies evaluated IL 1 beta and TNF alpha effects on steady state and GH stimulated IGF 1 synthesis and GH receptor mRNA levels . ^^^ In rat hepatocytes in primary culture , IGF 1 released into culture medium was determined by radioimmunoassay , and quantitative competitive polymerase chain reaction was used to measure IGF 1 mRNA and GH receptor mRNA concentrations . ^^^ Growth hormone increased GH receptor mRNA , IGF 1 mRNA and IGF 1 protein secreted into the culture medium . ^^^ In cells not stimulated with GH , modest inhibitory effects of IL 1 beta on GH receptor mRNA , IGF 1 mRNA and IGF 1 protein levels were seen . ^^^ Both IL 1 beta and TNF alpha in submaximal dose had additive inhibitory effects on IGF 1 protein concentrations but these effects did not result in irreversible damage to cells , as indicated by restoration of IGF 1 and GH receptor mRNA levels to normal after withdrawal of cytokines . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Effect of different serum concentrations of growth hormone binding protein ( GHBP ) on the regulation of GH receptor / GHBP gene transcription in a human hepatoma cell line . ^^^ Although high affinity growth hormone ( GH ) binding protein ( GHBP ) seems to mirror tissue GH receptor ( GH R ) status and effects GH kinetics , the physiological importance and ultimate biological role of GHBP remain largely unknown and obscure . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To determine a potential mechanism of reduced hepatic IGF 1 gene expression in uremia , the hepatic GH receptor gene expression in the same experimental animals was analyzed by specific solution hybridization / RNase protection assay . ^^^ Uremic animals had a 20 30 % reduction of hepatic GH receptor mRNA abundance compared with controls . ^^^ Our study shows that hepatic IGF 1 gene expression was specifically reduced in uremia , partially as the consequence of a reduced hepatic GH receptor gene expression . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To further elucidate this point , we quantitated hepatic IGF 1 , IGF binding protein 3 ( IGFBP 3 ) , and GH receptor messenger RNAs ( mRNAs ) expression in obese Zucker rats under different serum GH and insulin conditions using lean rats as controls . ^^^ No differences in GH receptor / GH binding protein mRNAs were found in any experimental condition . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To determine the potential role of the GH receptor ( GHR ) and the GH binding protein ( GHBP ) in this GH resistance , we assessed the GHR and GHBP mRNAs response to these cytokines . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In conclusion , a low insulin like growth factor 1 in diabetic children seems to depend on a GH receptor and / or a postreceptor defect . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
However , patients with isolated GH deficiency ultimately undergo spontaneous puberty , and women with GH receptor defects are fertile , suggesting that GH most likely acts as a co gonadotropin to augment the actions of FSH and LH on estradiol and progesterone production . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH receptor ( GHR ) is a member of the cytokine receptor family . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This hepatic insensitivity to the action of GH may be partially the consequence of a reduced GH receptor expression in liver tissue . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have very recently reported a child with short stature and a mutant GH caused by a single missense mutation in the GH 1 gene , which itself can not transduce the GH signal to the cells but can blunt the action of wild type GH by virtue of its greater affinity for the GH binding protein ( GHBP ) / GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have recently shown that GH promotes the rapid association of GH receptor with the tyrosine kinase JAK 2 , activates JAK 2 , and promotes the tyrosyl phosphorylation of both JAK 2 and GH receptor . ^^^ This suggests that the initial signalling event in GH action is the activation of JAK 2 which in turn phosphorylates tyrosines within JAK 2 and GH receptor . ^^^ We have identified a number of proteins that appear to bind to these phosphotyrosines in GH receptor / JAK 2 complexes . ^^^ Using truncated and mutated GHR , two regions of the GH receptor were identified required for the inhibitory effect of glucocorticoids . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A case of abnormal growth hormone secretion possibly caused by low somatomedin production of unknown origin : is the unresponsiveness of GH receptor responsible for it . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In humans , the circulating high affinity GH binding protein ( GHBP ) is thought to reflect GH receptor expression , because it is derived from the extra cellular domain of the GH receptor by proteolytic cleavage . ^^^ It is suggested that low GHBP levels in children with CRF represent a quantitative tissue GH receptor deficiency as one of the molecular mechanisms of GH insensitivity . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
It has been previously demonstrated that growth hormone ( GH ) stimulated tyrosine phosphorylation of Jak 2 and Stat5a and Stat5b occurs in FDP C 1 cells expressing either the entire GH receptor or truncations of the cytoplasmic domain expressing only the membrane proximal 80 amino acids . ^^^ Here we have defined a region in the human GH receptor between amino acids 520 and 540 in the cytoplasmic domain that is required for attenuation of GH activated Jak / Stat signaling . ^^^ These results delineate a novel domain in the GH receptor that regulates the inactivation of the Jak / Stat pathway and appears to be modulated by SHP 1 . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To investigate whether kidney GH receptor ( GHR ) and / or GH binding protein may play a role in diabetic nephropathy , we evaluated GH specific binding and messenger RNA levels for GHR / GH binding protein in mouse livers and kidneys from bovine ( b ) GH or bGHA transgenic ( Tg ) mice and their nontransgenic ( NTg ) littermates with or without STZ induced diabetes . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To determine whether GH receptor ( GHR ) cytoplasmic tyrosine residue ( s ) and tyrosine phosphorylation are required for signal transduction , we have substituted the eight porcine ( p ) GHR cytoplasmic tyrosines with phenylalanine individually or in a stepwise manner from the C terminus . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone insensitivity ( GHI ) may be primary , caused by defects in the GH receptor , or further along the GH insulin like growth factor 1 ( IGF 1 ) axis , or secondary , resulting from a variety of illnesses or malnutrition affecting various steps in the pathway from the GH binding to IGF 1 action . ^^^ GH receptor deficiency , although rare , with only 229 cases reported , is the most common cause of primary GHI . ^^^ The Ecuadorian patients share a splice site mutation in the GH receptor gene with at least one Israeli patient of Iberian origin ; 27 other mutations and a major deletion have been described in other affected patients . . ^^^ Growth hormone insensitivity ( GHI ) may be primary , caused by defects in the GH receptor , or further along the GH insulin like growth factor 1 ( IGF 1 ) axis , or secondary , resulting from a variety of illnesses or malnutrition affecting various steps in the pathway from the GH binding to IGF 1 action . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The patient ' s normal GH bioactivity and reduced GH binding protein concentration supports the current belief that chronic renal failure leads to an increase in peripheral tissue resistance to GH due to decreased GH receptor numbers . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
It is concluded that bovine cumulus cells , mural granulosa , and oocytes express mRNA for the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
RNA phenotyping shows transcripts for the GH receptor and GH binding protein in mouse preimplantation embryos of all stages from fertilized eggs ( day 1 ) to blastocysts ( day 4 ) . ^^^ An antibody specific to the cytoplasmic region of the GH receptor revealed receptor protein expression , first in two cell embryos , the stage of activation of the embryonic genome ( day 2 ) , and in all subsequent stages . ^^^ GH receptor immunoreactivity was also observed in cumulus cells associated with unfertilized oocytes but not in the unfertilized oocytes . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Together with the results of our previous studies showing that c fos gene expression was induced by systemic administration of GH and that GH receptor mRNA was contained in somatostatin neurons in the PeV and NPY neurons in the ARC , the data of the present study indicate that GH , but not IGF 1 , acts on the cells in the ARC and the PeV or in their vicinity to inhibit its own secretion , presumably by activating the somatostatin and NPY neurons . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptor function and its evaluation ] . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In season elevations in GH , with concomitant reductions in GHBP and IGF 1 , that were reversed during the postseason suggest a reduction in GH receptor number and partial GH resistance during the season . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptor immunoreactivity was present in small proliferating progenitor cells , myofibroblast like cells , large reticular fibroblast cells , adipocytes and endothelial cells . ^^^ GH receptor immunoreactivity on differentiating and / or differentiated cells suggests that GH is also necessary for , or has a trophic function in differentiation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Reverse transcriptase PCR analysis indicated that GH receptor mRNA was present in H 4 2 E cells at approximately 40 % of the level seen in rat liver . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The role of GH receptor tyrosine phosphorylation in Stat 5 activation . ^^^ Stimulation of GH receptors leads to rapid activation of Jak 2 kinase and subsequent tyrosine phosphorylation of the GH receptor . ^^^ Three specific tyrosines located in the C terminal domain of the GH receptor have been identified as being involved in GH stimulated transcription of the Spi 2 . 1 promoter . ^^^ Similarly , these GH receptors were found to be able to mediate activation of Stat 5 DNA binding activity , whereas the GH receptor mutant lacking all intracellular tyrosines was not . ^^^ Synthetic tyrosine phosphorylated peptides corresponding to the GH receptor sequence around the three tyrosines inhibited Stat 5 DNA binding activity while their non phosphorylated counterparts were ineffective . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The purpose of this study was to determine the role of growth hormone ( GH ) in regulating expression of the chicken GH receptor ( cGHR ) gene by comparing the levels of cGHR mRNA in livers of normal chickens with that of GHR deficient dwarf chickens . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Indeed , the dwarfism , elevated plasma GH , low plasma insulin like growth factor 1 , and development of obesity seen in STAT5b / mice are all characteristics of Laron type dwarfism , a human GH resistance disease generally associated with a defective GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Comparative studies in 2 subjects with GH receptor deficiency showed no response to exogenous GH . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Chronic administration of growth hormone ( GH ) to adult chickens exerts marked effects on circulating concentrations of insulin like growth factor 1 ( IGF 1 ) , IGF binding proteins , hepatic GH regulated gene 1 , and hepatic GH receptor mRNA . ^^^ Adult chickens showed other manifestations of increased responsiveness to GH , including elevated hepatic expression of GH regulated gene 1 ( mRNA ) with GH treatment ( p < 0 . 05 ) , and a tendency ( p < 0 . 08 ) for decreased GH receptor mRNA . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
No effects were seen on LV weight , cardiac insulin like growth factor ( IGF ) 1 , IGF 1 receptor and GH receptor mRNA content . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Human GH ( hGH ) treatment ( 50 nM ) of Chinese hamster ovary ( CHO ) cells stably transfected with the complementary DNA for the rat GH receptor ( CHO GHR ( 1 638 ) ) resulted in a reorganization of actin filaments in the cell that was not observed upon GH treatment of the untransfected parental CHO cell line . hGH initially induced depolymerization of actin stress fibers similar in magnitude to that induced by treatment of the cells with 100 nM human insulin like growth factor 1 . ^^^ Similar cytoskeletal changes were observed after hGH treatment in Swiss 3T3 fibroblasts and BRL cells stably transfected with rat GH receptor complementary DNA ( BRL GHR ( 1 6381 ) ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In this paper , we demonstrate ( in COS cells expressing rat GH receptor ( rGHR ) and either Stat5A or Stat5B , 3T3 F442A fibroblasts , and CHO cells expressing rGHR ) that GH induces tyrosyl phosphorylation of both Stat5A and Stat5B . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In this study , pregnant ( days 8 , 15 , and 20 of gestation ) and postpartum ( days 3 and 8 postpartum , including lactating and nonlactating dams ) Wistar rats were used to investigate pituitary GH gene expression and hormone secretion , and the potential alterations of the major signals regulating GH secretion and action [ somatostatin ( SS ) and GH releasing hormone ( GHRH ) , GH receptor ( GH R ) , and insulin like growth factor 1 ( IGF 1 ) ] . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptor ( GHR ) has been reported to express in both normal rat and human adrenals . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
At one extreme , mutations that nullify the function of the GH receptor are linked to complete GH insensitivity syndrome , or Laron syndrome , and we hypothesized that less disruptive mutations could contribute to partial GH insensitivity syndrome . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Subjects with low GHBP levels were among those tested for GH receptor mutations . ^^^ CONCLUSION : GHBP levels are GH independent and not predictive of responses to GH therapy , although low GHBP levels may indicate GH receptor abnormalities and partial GH insensitivity . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The hypothesis that growth hormone binding protein ( GHBP ) has an effect on its own on the regulation of the GH receptor / GHBP transcription was tested . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This study reports rapid effects of growth hormone ( GH ) on the intracellular free calcium concentration ( [ Ca2+ ] 1 ) in Chinese hamster ovary ( CHO ) cells stably expressing rabbit GH receptor . [ Ca2+ ] 1 was measured by spectrofluorimetric methods in single cells and membrane Ca2+ currents by patch clamp techniques in the whole cell configuration . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Laron type dwarfism ( LTD ) is an autosomal recessive disorder due to mutations in the GH receptor ( GHR ) gene . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH receptor is essential for the actions of GH on growth and metabolism . ^^^ Electromobility shift assay established that a 42 bp enhancer element in the promoter of the L 1 transcript of the murine GH receptor bound nuclear proteins specific for the coding strand or the DNA duplex . ^^^ Transient transfection experiments support the role of SSBP as a repressor of DSBP ' s activation of transcription of the GH receptor gene . ^^^ We conclude that single and double strand DNA binding proteins conjointly regulate the expression of the murine GH receptor gene . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In muscle GH receptor and IGF 1 gene expression , IGF 1 peptide and IGF binding protein 5 ( IGFBP ) levels were decreased . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
CONCLUSIONS : When acromegaly occurs without GH level elevation , one should pay attention that : 1 ) IGF 1 might be the cause of the clinical feature of acromegaly ; 2 ) The tumour might undergo morphological transformation ; and 3 ) Hyperinsulinemia or GH receptor antibody formation could also be the cause of the acromegalic appearance . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The locus of mutation D112G was found within site 2 of the GH molecule in binding with GH receptor ( GHR ) / GH binding protein ( GHBP ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In murine species , the GH receptor ( mGHR ) gene encodes a full length membrane anchored mGHR and a truncated soluble receptor ectodomain ( the GH binding protein ; mGHBP ) . ^^^ In order to begin to dissect the factors responsible for regulating expression of mGHR and mGHBP , we have cloned a mouse GH receptor / binding protein ( mGHR / BP ) minigene consisting of two mGHR cDNA fragments and an mGHR / BP genomic sequence , such that the mGHR and mGHBP can be derived from the minigene by mimicking native alternative pre mRNA splicing . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
However , mRNA for GH receptor was most abundant ( p < 0 . 05 ) in the membrana granulosa and oocytes of small antral and preantral follicles . ^^^ Compared to levels in controls and HPD ewes , the level of GH receptor mRNA was lower ( p < 0 . 05 ) in follicles obtained from HPX ewes . ^^^ The observed reduction of mRNA for GH receptor in the membrana granulosa of follicles from HPX ewes provides evidence that GH may play an important role in early stages of folliculogenesis and that it is involved in the maintenance of sensitivity to gonadotropins . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Serum levels of the high affinity GH binding protein that presumably reflects GH receptor status in tissues were normal . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
It also includes some data on the age related effects on the expression of the GH receptor messenger ribonucleic acid ( mRNA ) in certain brain areas . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To examine pathways coupling GH receptor ( GHR ) to MAP kinase activation , we have determined the effects of GH on SHC growth factor receptor bound 2 son of Sevenless ( SHC Grb 2 SOS ) association and activation of Ras , Raf , and MAP ERK kinase ( MEK ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In summary , ovarian derived GH N and PL A / B synthesis correlates well with the established local cascade of GHRH , GHRH receptor , GH receptor , IGF 1 , and IGF 1 receptor as a putative para / autocrine regulator of ovarian reproductive function . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
BAF / B03 lines were created and characterized which stably expressed hGH receptor , R43L hGH receptor , rabbit GH receptor , and L43R rabbit GH receptor . ^^^ Accordingly , for the first time we have been able to engineer a non primate hormone to bind to and activate the human GH receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH insensitivity syndrome ( GHIS ) is associated with many different mutations of the GH receptor ( GHR ) gene . ^^^ Fifteen different GH receptor gene mutations were identified in 27 patients . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Amplification with PCR and direct sequencing of her GH receptor gene revealed compound heterozygous mutations . ^^^ RT PCR of her father ' s lymphocytes and sequencing of its complementary DNA revealed that only the wild type GH receptor messenger RNA was expressed in his lymphocytes , though the mechanism remains unclear . ^^^ These results suggest that neither of the mutant alleles could generate a functional GH receptor , which would be consistent with the patient ' s severe growth retardation and undetectable serum GHBP . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Previously , we reported the identification of a new human GH receptor ( hGHR ) messenger RNA species that encodes a smaller hGHR isoform , termed hGHRtr . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Laron syndrome [ growth hormone ( GH ) insensitivity syndrome ] is a hereditary dwarfism resulting from defects in the GH receptor ( GHR ) gene . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
CONCLUSIONS : GH receptor expression on immune cells in non syndromic short children appears to be inversely related to the linear growth expression and BMI of the subjects , contrary to findings with hepatic derived serum GHBP . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Laron syndrome ( LS ) is a hereditary form of GH resistance due to molecular defects in the GH receptor ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Serum levels of GH binding protein ( a circulating fragment of the GH receptor ) and hepatic GH receptor mRNA levels were not significantly changed . ^^^ Growth plate GH receptor mRNA and IGF 1 mRNA levels were both increased during fasting . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In liver , 125I labelled bovine GH ( bGH ) specific binding ( P < 0 . 05 ) and GH receptor ( GHR ) mRNA levels ( P < 0 . 05 ) were higher in pGH treated than in control pigs . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The present study investigates whether estrogen regulates GH action and GH receptor expression in osteoblasts . 17 beta estradiol or GH added to the culture medium as single substances did not influence rat osteosarcoma cell proliferation nor human osteoblast like ( hOB ) cell proliferation . ^^^ However , together they synergistically induced osteoblast proliferation ( rat osteosarcoma cells 160 . 1 + / 15 . 5 % of control cells ; human osteoblast like cells 159 . 6 + / 5 . 1 % of control cells ) . 17 beta estradiol stimulated 125I GH binding and GH receptor ( GHR ) mRNA levels in rat osteosarcoma cells . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The following study identifies exon 1A of the ovine ( o ) GH receptor gene , corresponding to the 5 ' UT of a developmentally regulated , liver specific transcript . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The IFA uses a binding site specific antibody in combination with GH binding protein ( GHBP ) in order to quantify only those GH molecules that are able to dimerize the extracellular domain of the GH receptor ( GHBP ) , which is a prerequisite for GH signal transduction in target cells . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
PD 98059 treatment of Chinese hamster ovarian cells , stably transfected with the GH receptor ( CHOA cells ) , abolished the GH induced MAPK activity . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
BRL cells expressing the GH receptor were transiently transfected with expression plasmids containing either the hGH or the bGH gene and the response of the cell was measured by CAT reporter plasmids requiring either STATs 1 and 3 or STAT 5 for their response . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
PCR products corresponding in size to the mouse GH receptor were detected in osteoclast precursor cells . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A minority of patients with Laron syndrome have normal serum GH binding protein ( GHBP ) , indicating that the defect is elsewhere than in the extracellular domain of the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Alleles of the growth hormone ( GH ) gene and GH receptor ( GHR ) gene were analyzed for association with juvenile body weight ( HBWT ) , age at first egg ( AFE ) , the hen day rate of egg production ( HDR ) , egg specific gravity ( SPG ) , and egg weight ( EWT ) in a strain of White Leghorns . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) signaling requires activation of the GH receptor ( GHR ) associated tyrosine kinase , JAK 2 . ^^^ Growth hormone ( GH ) signaling requires activation of the GH receptor ( GHR ) associated tyrosine kinase , JAK 2 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The reproductive importance of GH and IGF 1 was tested in cattle with a GH receptor deficiency ( GHRD ) that have reduced blood IGF 1 . ^^^ In conclusion , an important role for GH , GH receptor , and IGF 1 in ovarian function was supported because GHRD cattle had distinctly different patterns of ovarian development compared with control cattle . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) insensitivity syndrome with high serum GH binding protein levels caused by a heterozygous splice site mutation of the GH receptor gene producing a lack of intracellular domain . ^^^ Most of the GH receptor ( GHR ) gene abnormalities causing GH insensitivity syndrome ( GHIS ) are located in the region coding the extracellular domain , and serum GH binding protein ( GHBP ) levels , determined by ligand mediated immunofunctional assay , are low in most of the patients with GHIS . ^^^ Growth hormone ( GH ) insensitivity syndrome with high serum GH binding protein levels caused by a heterozygous splice site mutation of the GH receptor gene producing a lack of intracellular domain . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The finding that C / EBP alpha , like the GH receptor , is predominantly expressed in stem cell areas of the rat growth plate indicates a possible functional role for C / EBP alpha during early chondrogenic differentiation . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
It has been suggested that glucocorticoids regulate GH responses via the regulation of GH receptor expression . ^^^ The aim of the present study was to investigate whether cortisol plays a role in the regulation of GH receptor expression in cultured human osteoblasts . ^^^ The effect of serum starvation and cortisol on GH receptor expression was tested in human osteoblast ( hOB ) like cells . ^^^ Serum starvation for 24 h resulted in an increase in GH receptor mRNA levels ( 90 + / 1 % over control culture ) . ^^^ Cortisol increased GH receptor mRNA levels in a dose dependent manner with a maximal effect at 10 ( 6 ) M . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Immunoblot studies of the acid labile subunit ( ALS ) in biological fluids , normal human serum and in children with GH deficiency and GH receptor deficiency before and after long term therapy with GH or IGF 1 respectively . ^^^ OBJECTIVE : The aims of this investigation were ( a ) to study the presence of immunoreactive forms of the acid labile subunit ( ALS ) in different human biological fluids , ( b ) to define the age dependence of serum ALS in normal children and adults and ( c ) to compare the regulation of ALS by GH or IGF 1 in children with GH deficiency ( GHD ) and GH receptor deficiency ( GHRD ) before and after 1 year of therapy with GH or IGF 1 , respectively . ^^^ Acid labile subunit concentrations are age dependent with a sharp increase during adolescence , and are reduced in GH deficient and GH receptor deficient children . ^^^ While treatment with rhGH is able to increase and normalize acid labile subunit concentrations in GH deficient children , therapy with rhIGF 1 fails to increase serum acid labile subunit levels in GH receptor deficient patients . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A panel of five monoclonal antibodies was used in mapping the presence and somatic distribution of the GH receptor by immunohistochemistry in normal and neoplastic tissues and cultured cells of human , rat and rabbit origin . ^^^ Immunoreactivity showed subcellular localisation of the GH receptor in cell membranes and was predominantly cytoplasmic , but strong nuclear immunoreaction was also apparent in many instances . ^^^ Intense immunoreactivity was also observed in the cellular Golgi area of established cell lines and cultured tissue derived cells in exponential growth phase , indicating cells are capable of GH receptor synthesis . ^^^ The presence of intracellular GH receptor , previously documented in normal tissues of mostly animal origin , is the result of endoplasmic reticulum and Golgi localisation . ^^^ The nuclear localisation of immunoreactivity is the result of nuclear GH receptor / binding protein , identically to the cytosolic and plasma GH binding protein , using a panel of five monoclonal antibodies against the GH receptor extracellular region . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Continuous exposure to GH of BRL 4 cells , a rat hepatoma cell line stably transfected with rat GH receptor , induces a rapid but transient activation of Jak 2 and Stat 5 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH receptor is a member of the cytokine receptor superfamily . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Half of the carboxyl terminal region of the GH receptor is dispensable for FAK activation , but FAK activation does require the proline rich box 1 region of the GH receptor , indicative that FAK is downstream of JAK 2 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have examined the response of the renal insulin like growth factor ( IGF 1 ) axis to acute ischemic injury in the rat Key findings included a decrease in IGF 1 mRNA and peptide levels , a decrease in GH receptor gene plus protein expression and a decrease in the IGF binding proteins except for IGF binding protein 1 . ^^^ Administration of GH to compensate for the reduced GH receptor binding corrected the IGF 1 mRNA levels suggesting a relative GH deficiency . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We examined the ontogeny of mRNA levels of IGF 1 and 2 , IGF type 1 ( IGFI R ) and type 2 receptors ( IGFII R ) , IGF binding protein 1 and 3 ( IGFBP 1 and 3 ) , GH receptor ( GHR ) , and tissue concentrations of IGF and IGFBP in the pancreas of pigs . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The aim of this study was to investigate the effect of GH treatment on expression of the IGF 1 gene and GH receptor ( GHR ) gene in skeletal muscle after major surgery . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In order to begin to address the role of GH in the ontogeny of the immune response . cells from bovine fetal spleen and thymus were examined for GH receptor and responsiveness to GH . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The soluble growth hormone binding protein ( GHBP ) , which is encoded by the GH receptor ( GHR ) gene , is generated by several mechanisms . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Two isoforms of the GH receptor , the full length receptor ( GHRL ) and a short isoform ( GHRS ) that lacks the transmembrane and intracellular domains of GHRL , have been analyzed in rat tissue extracts by Western blotting and immunoprecipitation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This suggests a physiological pathway involving both GHBP ( the soluble fraction of GH receptor ) and leptin . ^^^ Thus , we might speculate that leptin could be the signal that induces the related nutritional changes observed in GHBP / GH receptor expression . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Grb 10 identified as a potential regulator of growth hormone ( GH ) signaling by cloning of GH receptor target proteins . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
At the tissue level , the pleiotropic actions of GH result from the interaction of GH with a specific cell surface receptor , the GH receptor ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Indeed , hepatic gene expression for both GH receptor and IGF 1 was markedly reduced by fasting , and no correction was seen with leptin treatment . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Dexa time dependently suppressed the transcription of GH receptor ( GHR ) messenger RNA ( mRNA ) and down regulated the basal and GH stimulated expression of GHR . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Heterozygosity for certain mutations of the GH receptor ( GHR ) gene has been proposed as the cause of partial resistance to GH , and there has been a recent demonstration of a dominant negative effect of such a mutation in a mother and child . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The present study represents a detailed analysis of GH receptor ( GHR ) expression in cirrhotic liver from 17 patients with end stage liver disease . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Sequencing and in vitro analysis identified a homozygous base pair substitution in exon 6 of the proband ' s GH receptor ( GHR ) , which changed amino acid 131 from proline to glutamine ( P131Q ) and disrupted GH binding . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Hepatic mRNA for GH receptor and IGF 1 was decreased in infected calves . ^^^ Furthermore , the onset of APR overrode the capacity for GH to maintain elevated plasma concentrations of IGF 1 , an effect not readily explained through changes of GH receptor binding . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The complex 125I hGH BP could be precipitated by a monoclonal anti GH receptor antibody , suggesting a close relationship between the plasma GH BP and the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A RIA for mouse GH receptor ( mGHR ) was developed . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In conclusion , it can be hypothesized that the overnutrition causes hyperinsulinemia which increases GH receptor and IGF 1 secretion despite low GH secretion . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptor gene mutations and growth failure ] . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A genomic clone spanning 16 kb of the GH receptor gene was mapped and used as a probe for identifying restriction fragment length polymorphisms ( RFLPs ) in chickens . ^^^ The results indicate the presence of a genetic variant of the GH receptor gene which affects growth and abdominal fat deposition and which is relatively frequent in egg laying as well as in meat type chickens . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
OBJECTIVE : Genotype and phenotype heterogeneity in patients with GH insensitivity syndrome suggests that partial defects exist in the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In two patients with growth hormone ( GH ) insensitivity syndrome ( Laron syndrome ) , in whom the GH receptor is able to bind the hormone , the D152H mutation was identified , and lack of dimerization was proposed to explain GH resistance in these patients . ^^^ To examine further the consequences of the substitution of conserved aspartate 152 on the function of the GH receptor ( GHR ) , we reproduced the mutation in vitro on the full length GH receptor cDNA from man and rat . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptor gene expression was shown in TEC in primary cultures and in fetal and postnatal TEC lines as well as in thymocytes . ^^^ In cytofluorometric studies with the use of a biotinylated anti GH receptor monoclonal antibody , we could show that GH receptors are predominantly expressed by immature thymocytes : over 90 % of CD 3 CD 4 CD 8 CD 19 CD34+ CD 2 cells ( a phenotype characterizing the most immature T cell progenitors in the thymus ) were GH receptor positive . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Gene expression of GH receptor was analyzed with reverse transcriptase polymerase chain reaction ( RT PCR ) method . ^^^ The GH receptor mRNA expression differed in the childrens lymphocytes , showing no correlation with the effect of GH on lymphoproliferation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
It is now recognized that ( a ) the replacement dose of rhGH ranges from 0 . 175 to 0 . 35 mg / kg / week and should be individualized ; ( b ) dividing this dose into 6 or 7 daily subcutaneous injections is more effective than giving the same total dose in three weekly portions , and ( c ) final height correlates significantly with pretreatment chronologic age , height SDS and predicted adult height , duration of therapy , birth length , in some studies height SDS and age at start of puberty , weight , and serum GHBP ( an indicator of GH receptor mass ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Mapping of single stranded DNA configurations reveals that MSY 1 can facilitate the formation of single stranded DNA regions in the GH receptor 5 ' flanking region . ^^^ Transient transfection experiments support the role of MSY 1 as a repressor of GH receptor gene activation . ^^^ Southwestern blot analysis indicates that the levels of nuclear MSY 1 are decreased in the livers of pregnant mice , suggesting a role for MSY 1 in the increased expression of the GH receptor during pregnancy . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To elucidate the effect of growth hormone ( GH ) on the insulin signal transduction pathway leading to the translocation of glucose transporter 4 ( GLUT 4 ) , we constructed Chinese hamster ovary cells that overexpressed GH receptor and GLUT 4 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH pathway genes include ligands ( GH and insulin like growth factor 1 [ lGF 1 ] ) , transcription factors ( prophet of pit 1 , or prop 1 and pit 1 ) , agonists and antagonists ( growth hormone releasing hormone [ GHRH ] and somatostatin ) , and receptors ( GHRH receptor [ GHRHR ] and the GH receptor [ GHR ] ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have investigated the effect of GH on microtubular physiology in Chinese hamster ovary ( CHO ) cells stably transfected with the complementary DNA for the rat GH receptor ( CHO GHR ( 1 638 ) ) . ^^^ The proline rich box 1 region of the GH receptor was required for hGH to stimulate tubulin polymerization indicative that this event is JAK dependent . ^^^ Increased tubulin polymerization still occurred in response to hGH in a receptor truncation lacking the carboxyl terminal half of the intracellular domain of the GH receptor indicative that hGH induced changes in intracellular calcium concentration is not required for tubulin polymerization . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This review uses the GH receptor as a model system for studying cytokine signaling and summarizes some of the data used to establish JAK 2 as a GH receptor associated tyrosine kinase and to identify signaling molecules that lie downstream of JAK 2 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptor mRNA was demonstrated to be present in these neurons by in situ hybridization . ^^^ Taken together , these findings suggest that GH acts on NPY neurons in the ARC and somatostatin neurons in the PeV through GH receptor , and the activation of these neurons augments somatostatin release and inhibits GH secretion . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In Exp 2 , the effects of a GH receptor antagonist ( Trovert , Sensus Corp . ) was assessed in ovariectomized , young adult , treated females ( GHa ; 1 . 0 mg / kg , s . c . , weekly ) and compared with that in untreated cohorts ( Con ) during 3 weeks of no estradiol and 3 weeks of estradiol replacement ( 3 microg / kg 10 day , s . c . ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Homozygous or compound heterozygous mutations in the GH receptor ( GHR ) gene result in GH insensitivity syndrome . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This article focuses on the signalling pathways emanating from the PRL receptor ( PRL R ) and GH receptor ( GH R ) , and the expression of PRL inducible target genes . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We now show here in Chinese hamster ovary cells stably transfected with rat GH receptor cDNA that human ( h ) GH induces the formation of a large multiprotein signaling complex centered around another FAK associated protein , p 130 ( Cas ) and the adaptor protein CrkII . hGH stimulates the tyrosine phosphorylation of both p 130 ( Cas ) and CrkII , their association , and the association of multiple other tyrosine phosphorylated proteins to the complex . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have analyzed the GH receptor ( GHR ) gene in four individuals with Laron syndrome , and a missense mutation was identified for each patient in the extracellular domain of the GHR ( D152H , I153T , Q154P , and V155G ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Superior school performance was reported for 52 Ecuadorian probands with severe deficiency of insulin like growth factor 1 ( IGF 1 ) due to GH receptor deficiency ( GHRD ) resulting from homozygosity for the E 180 splice mutation of the GHR . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) insensitivity is associated with several different mutations of the GH receptor gene and a recently described new genetic disorder of the IFGI gene . ^^^ Fifteen different mutations of the GH receptor gene were identified in 27 patients . ^^^ There were no relationships between the type of mutation or the involved GH receptor gene exon and height or IGFBP 3 SDS . ^^^ Growth hormone ( GH ) insensitivity is associated with several different mutations of the GH receptor gene and a recently described new genetic disorder of the IFGI gene . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have investigated the role of caveolae in the internalization of GH in CHO cells stably transfected with GH receptor cDNA ( CHO GHR 1 638 ) . ^^^ We show by immunogold electron microscopy that a portion of the GH receptor at the cell surface is localized to or near caveolin containing structures and upon GH stimulation the receptor aggregates in caveolae . ^^^ Transient transfection of caveolin cDNA into CHO cells concomitantly transfected with GH receptor cDNA increases both the internalization of hormone and the GH stimulation of STAT mediated transcription . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH stimulates the tyrosine phosphorylation of various cellular polypeptides , including the GH receptor itself , in an early part of the intracellular response . ^^^ Some of these phosphorylations are catalyzed by a GH receptor associated kinase identified as JAK 2 , a member of the Janus family of tyrosine kinases . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The human GH receptor ( hGHR ) contains nine intracellular and seven extracellular cysteines , of which six are linked by disulfide bonds and one , at position 241 proximal to the membrane , is free . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH inhibition of PPARalpha activity required GH receptor and STAT5b and was not observed using GH activated STAT 1 in place of STAT5b . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone dependent tyrosine phosphorylation of a GH receptor associated high molecular WEIGHT protein immunologically related to JAK 2 . ^^^ A critical step in growth hormone ( GH ) signalling is the GH induced activation of the GH receptor ( GHR ) associated tyrosine kinase , JAK 2 . ^^^ Growth hormone dependent tyrosine phosphorylation of a GH receptor associated high molecular WEIGHT protein immunologically related to JAK 2 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Affected individuals had similarities to and significant differences from patients with insulin like growth factor 1 ( IGF 1 ) deficiency due to GH receptor deficiency ( GHRD ) and normal thyroid function and sexual maturation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The aim of this study was to assess the GH IGFI axis , GH receptor availability , as reflected by the levels of GH BP , and the amount of GH dependent IGFBP 3 in adult IDDM patients with different degrees of metabolic control . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
By mutational analysis we have identified different functional domains of the cytoplasmic part of the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Increased STAT5b DNA binding activity was observed in cells treated with the proteasome inhibitor MG 132 , suggesting that at least one component of the GH receptor ( GHR ) JAK 2 STAT5b signaling pathway becomes labile in response to continuous GH treatment . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In multiple cell types , laser scanning confocal imaging of GFP Stat5B co expressed with GH receptor shows that GFP Stat5B undergoes a rapid , dramatic accumulation in the nucleus upon GH stimulation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To elucidate the mechanism by which GH stimulates the transcription of the IGF 1 gene , we transiently transfected Hep3B cells expressing the rat GH receptor with a sIGF 1 promoter luciferase reporter construct . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptor gene knockout ( GHR KO ) mice were recently produced . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To address the mechanisms that might trigger GH insensitivity in sepsis , we investigated the regulation of liver GH receptor ( GHR ) and its gene expression by endotoxin . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A soluble protein that specifically bound growth hormone ( GH ) was characterized in culture medium of a COS 7 cell line transfected with the cDNA of the full length chicken GH receptor ( cGHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have previously reported a novel heterozygous donor splice site mutation in intron 9 of the GH receptor ( GHR ) gene in Japanese siblings who showed partial GH insensitivity and high serum GH binding protein ( GHBP ) levels . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The pathobiology of GH insentivity may reflect decreased nutritional intake , low GH receptor density , decreased IGF 1 half life and hepatic insensitivity to insulin . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In the contralateral hemisphere , both IGF 1 and GH receptor mRNA had increased by 14 d after the insult ( 0 . 36 + / 0 . 042 vs 0 . 13 + / 0 . 011 , p < 0 . 05 , and 0 . 31 + / 0 . 013 vs 0 . 11 + / 0 . 004 amol / microg DNA , p < 0 . 001 , respectively ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In this study , we demonstrate that GH receptor messenger RNA ( mRNA ) is preferentially expressed in progenitor Leydig cells ( PLCs ) isolated and purified from 21 day old rats . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) insensitivity is a heterogeneous condition that can result from mutations within the GH receptor ( GHR ) and that can be inherited as both an autosomal recessive and a dominant trait . ^^^ Growth hormone ( GH ) insensitivity is a heterogeneous condition that can result from mutations within the GH receptor ( GHR ) and that can be inherited as both an autosomal recessive and a dominant trait . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH treatment of Chinese hamster ovary cells stably transfected with the GH receptor ( CHOA cells ) led to rapid and transient activation of both STAT5a and ERK 1 and ERK 2 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH binding protein ( GHBP ) corresponds to the extracellular domain of the GH receptor ( GHR ) and has been shown to be closely related to body fat . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH induces activation of the GH receptor ( GHR ) associated cytoplasmic tyrosine kinase , JAK 2 , resulting in tyrosine phosphorylation of the GHR and activation of STAT ( signal transducer and activator of transcription ) , Ras mitogen activated protein kinase , and phosphoinositol 3 kinase signaling pathways , among others . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Liver RNA was analyzed for mRNAs specific for the GH receptor , IGF 1 , IGF 2 , and IGF binding protein 3 . ^^^ Liver GH receptor mRNA was unaffected ( P > 0 . 5 ) by pGH treatment , but was greater in the 6 wk old group ( P < 0 . 0001 ) and in piglets maintained at the high temperature ( P = 0 . 04 ) . ^^^ The relatively lower level of GH receptor and IGF mRNAs in conjunction with greater growth in the cold environment suggests that somatotrophic gene expression in the liver is not rate limiting for growth in the neonatal pig . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Insulin deficiency results in a decrease in liver GH receptor ( GHR ) expression , which can be reversed by insulin administration . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
IGF 1 deficiency due to GH receptor deficiency . ^^^ IGF 1 deficiency may be primary due to defective synthesis , or secondary to GH receptor deficiency ( GHRD ) or defects in transduction of the GH GHR signal . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Because IGF 1 is regulated by growth hormone ( GH ) and because kidney GH receptor expression is also attenuated in ARF , the impaired IGF 1 expression may partly reflect local GH resistance . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Differential regulation of IGF 1 , its receptor and GH receptor mRNAs in the right ventricle and caval vein in volume loaded genetically hypertensive and normotensive rats . ^^^ The right ventricular ( RV ) and the caval vein IGF 1 mRNA and RV IGF 1 receptor and GH receptor mRNAs were quantitated by means of solution hybridisation assay . ^^^ Two days after shunt opening in SHR , RV and caval vein IGF 1 mRNA increased by 57 % and 108 % ( P < 0 . 05 for both , n=5 6 in each group ) respectively , and these expressions were then turned off , whereas RV GH receptor and IGF 1 receptor mRNA expression remained unaffected compared with WKY rats . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The dwarf chickens examined exhibit a Laron type dwarfism and have been shown to be GH receptor deficient . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This resistance to GH action is thought to be due to mutations of the GH receptor ( GHR ) gene that reduce or prevent GH binding to target sites . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To investigate the effect of a newly developed GH receptor ( GHR ) antagonist ( G120K PEG ) on renal / glomerular hypertrophy and urinary albumin excretion ( UAE ) , streptozotocin induced diabetic and nondiabetic mice were injected with G120K PEG every 2nd day for 28 days . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
B 2036 PEG , a GH receptor ( GH R ) antagonist , is an analog of GH that is PEG modified to prolong its action . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Serum concentration of IGF 1 and liver mRNA expression of IGF 1 , IGF binding proteins and GH receptor were measured . ^^^ Contrary to the results obtained with a longer period of recovery , these experiments show that serum and mRNA expression of IGF 1 and IGFBPs in adult undernourished diabetic rats can be restored by insulin and nutrients administration with no prior restoration of serum and pituitary GH to control values and no compensatory changes in GH receptor gene expression . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To develop such a cell line , we used rat C 6 glioma cells which , as determined by RNase protection assay , express the IGF 1 gene but not the GH receptor gene . ^^^ To confer GH responsiveness , C 6 cells were cotransfected with vectors that express the GH receptor ( pRc / CMV WTrGHR ) and Jak 2 ( pRc / CMV Jak 2 ) . ^^^ In summary , transient expression of the GH receptor and Jak 2 in C 6 cells creates a GH responsive system that activates STAT 1 , 3 , and 5 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptors ( GHRs ) and PRL receptors ( PRLRs ) were studied in human peripheral blood mononuclear cells ( PBMC ) using flow cytometry , biotinylated anti GH receptor monoclonal antibody 10B8 , and biotinylated human PRL . ^^^ Variations of GHR and PRLR expression and the relationship of plasma GHBP and GH receptor in PBMC subsets were examined as a function of age and sex . ^^^ By double immunofluorescence staining , we show that about 30 % of total cells express GH receptors , with a low expression in T cells , whereas almost all B cells and monocytes are GH receptor positive . ^^^ In T cells , monocytes and B cells , no significant changes are detected in either the percentage of GH receptor positive cells or in the GH receptor level per cell . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
METHODS : Polymerase chain reaction and ribonuclease protection assays were used to demonstrate that GH receptor messenger RNA was present in all 14 meningioma specimens studied , regardless of tumor grade . ^^^ Both wild type ( GHRwt ) and a previously described exon 3 deletion isoform ( GHRd 3 ) of the GH receptor were identified in individual tumor specimens . ^^^ The importance of the GH receptor was assessed using a GH receptor antagonist ( B 2036 ) . ^^^ Blockade of the GH receptor with B 2036 reduced serum induced DNA synthesis , as measured by thymidine incorporation , by 8 to 33 % ( mean 20 % ) in primary meningioma cultures . ^^^ Blockade of the GH receptor on tumor cells inhibited tumor growth . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The expression of GH receptor messenger ribonucleic acid in the liver was greatly reduced . ^^^ In this patient , the decreased expression of GH receptor messenger ribonucleic acid in the liver may have been responsible for the GH resistance , which was probably caused by malnutrition . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Transcriptional upregulation of hepatic GH receptor and GH binding protein expression during pregnancy in the mouse . ^^^ In the mouse , GH binding protein ( GHBP ) and GH receptor ( GHR ) are encoded by a single gene via alternative splicing . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptor distribution in the ovine foetal adrenal gland : ontogenic and functional studies . ^^^ In order to examine the role of GH in the regulation of foetal adrenal development and function , we have localized GH receptor mRNA and protein in adrenal glands of ovine foetuses at specific stages of gestation . ^^^ GH receptor mRNA localization was studied by in situ hybridization using a ( 35 ) S labelled antisense cRNA probe , and protein by immunohistochemistry using a specific monoclonal antibody to the GH receptor . ^^^ At all ages studied , GH receptor mRNA and immunoreactivity could be detected throughout the adrenocortical region . ^^^ In adult adrenals , GH receptor mRNA and immunoreactivity were also evident throughout the adrenocortical zone , with the strongest expression confined to a defined region of cells at the interface between the zona glomerulosa and zona fasciculata . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To examine the hypothesis that expression of the growth hormone ( GH ) receptor accounts , in part , for the tissue specific expression of the IGF 1 gene during development , the developmental regulation of IGF 1 and GH receptor gene expression in rat tissues was examined . ^^^ The level of IGF 1 and GH receptor mRNA was quantified in RNA prepared from rats between day 17 of gestation ( E 17 ) and 17 months of age ( 17M ) using an RNase protection assay . ^^^ The changes in GH receptor mRNA levels were , in general , coordinate with the changes in IGF 1 mRNA levels , except in skeletal muscle . ^^^ Interestingly , quantification of GH receptor levels by Western blot analysis in skeletal muscle demonstrated changes coordinate with IGF 1 mRNA levels . ^^^ The levels of the proteins which mediate GH receptor signaling ( STAT 1 , 3 , and 5 , and JAK 2 ) were quantified by Western blot analysis . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The apparent M ( r ) ' s of the [ 125I ] human ( h ) GH receptor complexes were 380 , 205 , 90 , 62 , 52 and 38 kDa as demonstrated by an autoradiograph of affinity labelled cardiac GH receptors separated under non reducing conditions by SDS PAGE . ^^^ The [ 125I ] hGH cardiac GH receptor complexes were disulfide linked since the M ( r ) s of the complexes diminished to 170 , 116 , 97 , 71 , 45 and 38 kDa under reducing conditions , indicating the presence of multiple receptors , receptor associated macromolecules or receptor and ligand in various ratios . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These observations further demonstrate that the eight amino acid substitutions within binding site 1 provide binding specificity directed towards the human GH receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Thus , low IGF 1 levels are found in GH deficient patients as well as in patients with GH resistance due to malnutrition or GH receptor defects . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
It has also been reported that sex steroids influence not only GH secretion but also the local synthesis of IGF 1 in target tissues and the expression of the GH receptor in various other tissues . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
IGFBP 3 complexes measured by ELISA 1 and 2 in samples from normal individuals and subjects with GH deficiency , acromegaly , and GH receptor deficiency more tightly correlated with IGF 1 , IGFBP 3 , and ALS than IGF 2 . ^^^ ELISA 1 determinations were comparatively more age dependent and , in comparison to ELISA 2 , showed better discriminations among the various sample groups , particularly among GH receptor deficiency , normal , and GH deficiency subjects . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Transgenic ( TG ) mice expressing porcine GH receptor ( pGHR ) directed by a 762 bp proximal leptin promoter were used to analyze the capability of the promoter to drive and regulate pGHR expression in vivo . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptor ( GHR ) messenger RNA ( mRNA ) is transcribed from at least three different promoters within the liver of cattle . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Immunoreactivity showed subcellular localization of the GH receptor in cell membranes , was predominantly cytoplasmic , but strong nuclear immunoreaction was also apparent in many instances . ^^^ The nuclear localization of immunoreactivity is the result of nuclear GH receptor / binding protein , identically to the cytosolic and plasma growth hormone binding protein . ^^^ Intense immuno reactivity was also observed in the cellular Golgi area of established cell lines and cultured tissue derived cells in exponential growth phase , indicating cells are capable of GH receptor synthesis . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) and 17beta estradiol regulation of the expression of mouse GH receptor and GH binding protein in cultured mouse hepatocytes . ^^^ Isolated hepatocytes were plated in a rat tail type 1 collagen sandwich configuration to examine the regulation of GH receptor ( GHR ) and GH binding protein ( GHBP ) expression by GH and 17beta estradiol ( E 2 ) . ^^^ Growth hormone ( GH ) and 17beta estradiol regulation of the expression of mouse GH receptor and GH binding protein in cultured mouse hepatocytes . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Dexamethasone inhibits both growth hormone ( GH ) induction of insulin like growth factor 1 ( IGF 1 ) mRNA and GH receptor ( GHR ) mRNA levels in rat primary cultured hepatocytes . ^^^ The parallel decrease of GHR and GH induced IGF 1 mRNA suggests that the GH resistance caused by DXM is mediated by diminished GH receptor synthesis . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Testosterone was administered to peripubertal rats and the responses of mRNA of GH receptor , IGF 1 , IGF 1 receptor and IGF binding proteins 1 and 3 ( IGFBP 1 and IGFBP 3 ) as well as circulating IGF 1 were evaluated in two time related models : over 12 h after a single injection ( short term study ) and 10 days after continuous administration ( long term study ) . ^^^ Testosterone had no effect on hepatic GH receptor and IGFBP 3 mRNA levels but resulted in a transient , short term elevation in IGFBP 1 mRNA levels that was maximal 4 h post injection . ^^^ However , testosterone increased GH receptor mRNA abundance after 10 days of continuous administration in hypophysectomized rats only . ^^^ The small but significant elevation of GH receptor mRNA levels in hypophysectomized rats may suggest a testosterone mediated augmentation of a GH effect at the target organ . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Decreased nutrition leads to elevated GH secretion , but it reduces hepatic GH receptor ( GHR ) number and plasma levels of IGF 1 ; it also changes the relative concentrations of IGF binding proteins ( IGFBPs ) in plasma . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This is at least partly because of age related changes in tissue GH binding activity and GH receptor mRNA expression . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
There is clear evidence for a distinct GH receptor mRNA expression and protein production in follicles ( oocytes and granulosa cumulus cells ) and corpus luteum ( CL ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Despite the lack of response in growth , IGF 1 null mice have normal levels of GH receptor expression in the liver and increased liver Jun B expression and liver size in response to rhGH treatment . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The role of a specific GH receptor ( GHR ) antagonist in the development of early renal changes in nonobese diabetic ( NOD ) mice was investigated . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH receptor and GH insensitivity . ^^^ In congenital GHIS , over 30 mutations in the GH receptor ( GHR ) have been described . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Intracellular trafficking of GH and its receptor , more particularly the chicken GH receptor ( cGHR ) , was examined in COS 7 cells using biochemical and structural studies . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In this study we have investigated the role of suppressor of cytokine signaling ( SOCS ) proteins in GH receptor mediated signaling . ^^^ SOCS 1 inhibited the tyrosine kinase activity of Janus kinase 2 ( JAK 2 ) directly , while SOCS 3 only inhibited JAK 2 when stimulated by the GH receptor . ^^^ All four SOCS proteins were able to bind to a tyrosine phosphorylated glutathione S transferase GH receptor fusion protein , and SOCS 3 required the same 46 C terminal amino acids for GH receptor binding as it did for inhibition of GH mediated transcription and STAT 5 activation . ^^^ These data suggest that SOCS 1 and 3 can suppress GH induced transcriptional activity , presumably by inhibiting the kinase activity of JAK 2 either directly in the case of SOCS 1 or via binding to the tyrosine phosphorylated GH receptor in the case of SOCS 3 . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH exerts pleiotropic effects on growth and metabolism through the GH receptor . ^^^ A deficiency in the GH receptor gene is thus associated with GH resistance and dwarfism . ^^^ Complete GH resistance in humans , or Laron syndrome , has been associated with numerous inherited defects in the GH receptor , including point mutations , complete or partial gene deletions , and splice site alterations . ^^^ Analysis of the GH receptor genes of these patients has provided considerable insight into structure function relationships of the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone resistance induced by transgenic expression of an antagonistic bGH analog or by targeted disruption ( knock out , KO ) of the GH receptor ( GH R ) gene leads to dramatic suppression of plasma levels of insulin like growth factor 1 ( IGF 1 ) , and dwarf phenotype due to reduced growth and increased adiposity . ^^^ Growth hormone resistance induced by transgenic expression of an antagonistic bGH analog or by targeted disruption ( knock out , KO ) of the GH receptor ( GH R ) gene leads to dramatic suppression of plasma levels of insulin like growth factor 1 ( IGF 1 ) , and dwarf phenotype due to reduced growth and increased adiposity . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A missense mutation , C422F , was identified in the intracellular domain of GH receptor ( GHR ) in a Japanese short boy . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptor transcripts are characterized by the presence of disparate 5 ' untranslated exons . ^^^ Factors regulating the expression of the GC rich L 2 transcript of the murine GH receptor gene have hitherto remained unidentified . ^^^ Western blot analysis of liver nuclear extracts revealed that the levels of Sp 3 increase significantly after birth , suggesting a role for the Sp family of transcription factors in controlling the fetal to postnatal increase in GH receptor gene expression . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptor abundance was unchanged , suggesting a postreceptor site of endotoxin induced GH resistance . ^^^ The finding of endotoxin inhibition of in vivo STAT 5 tyrosine phosphorylation in response to a supramaximal dose of GH in the absence of a change in GH receptor abundance or total GH stimulated JAK 2 tyrosine phosphorylation provides the first demonstration of acquired postreceptor GH resistance . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We now supplement the information available on placental GH and describe the presence and distribution of GH receptor ( GH R ) messenger RNA ( mRNA ) in uterine , fetal , and placental tissues during early pregnancy . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In the present report , the characteristics of the GH receptor ( GHR ) are studied in these tissues . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In CHO cells stably expressing either the wild type ( wtGHR ) or a truncated form ( delta454GHR ) of the GH receptor in which GH induces a sustained activation of the receptor associated tyrosine kinase JAK 2 , we found that GH stimulation inhibited programmed cell death induced by withdrawal of survival factors . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
SOCS 1 , SOCS 2 , SOCS 3 , and CIS each strongly inhibited the GH receptor ( GHR ) dependent tyrosine phosphorylation of JAK 2 seen at low levels of transfected JAK 2 ; however , only SOCS 1 strongly inhibited the GHR independent tyrosine phosphorylation of JAK 2 seen at higher JAK 2 levels . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
METHODS : To elucidate a possible direct , permissive role of GH in CRG , we examined the effect of a newly developed specific GH receptor ( GHR ) antagonist ( G120K PEG ) on kidney IGF 1 accumulation and renal / glomerular hypertrophy over seven days after uninephrectomy in adult mice . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
However , since human adrenal glands express the intact GH receptor , the objective of this study was to investigate whether GH exerts a direct effect on the steroidogenesis and IGF BP synthesis in adult human adrenocortical cells . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Fifty patients with primary GH resistance ( Laron syndrome ) due to molecular defects of the GH receptor or post receptor pathways were followed from infancy through adulthood . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Using the mouse myeloid cell line , FDC P 1 , stably transfected with the full length ovine GH receptor ( oGHR ) , we demonstrate that rbGH causes a dose dependent increase in MTT formazan production by these cells . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Levels of GH receptor , the type 1 IGF receptor , and IGF binding protein 2 ( IGFBP 2 ) mRNAs were unchanged across the growth plate . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We demonstrate here that p 38 mitogen activated protein ( MAP ) kinase is activated in response to cellular stimulation by human GH ( hGH ) in Chinese hamster ovary cells stably transfected with GH receptor cDNA . ^^^ This activation requires the proline rich box 1 region of the GH receptor required for JAK 2 association and is prevented by pretreatment of cells with the JAK 2 specific inhibitor AG 490 . ^^^ ATF 2 is both phosphorylated and transcriptionally activated by hGH , and its transcriptional activation also requires the proline rich box 1 region of the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH exerts its biological action by stimulating JAK 2 , a GH receptor ( GHR ) associated tyrosine kinase . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Proteolysis of IGFBP 3 was previously reported to be present late at night in serum from pediatric subjects with GH receptor dysfunction ( GHRD or `` Laron type dwarfism ' ' ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This treatment did not result in increased production of either GH receptor or IGF 1 mRNA at either age . ^^^ There was a slight GH independent increase in GH receptor and IGF 1 mRNA expression by d 7 . ^^^ We conclude that there is apparent insensitivity to GH treatment in d 2 neonates that remits by d 7 and that this remission correlates with increased abundance of GH receptor and Stat5 . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have used RNase protection assays and in situ hybridization to address whether the mRNA expression of GH , somatostatin and GHRH , as well as of the GH receptor ( GHR ) in the hypothalamus and anterior pituitary , are altered in streptozotocin induced diabetic rats . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In most species , ovarian follicles and corpora lutea are potential sites for GH action because the GH receptor is found within granulosal cells as well as corpora lutea . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The pathogenesis of this syndrome is due to various molecular defects from exon deletion to nonsense , frameshift , splice and missense mutations in the GH receptor ( GH R ) gene or in its post receptor pathways . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The report of the presence of heterozygous mutations of the GH receptor in patients with idiopathic short stature has been confirmed by documentation of dominantly inherited mutations in familial short stature . ^^^ Molecular screening in our unit of a group of 31 children with idiopathic short stature and normal GHBP , failed to identify mutations of the intracellular domain of the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Transcription of GH receptor ( GHR ) mRNA is initiated from multiple promoters . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptor was expressed in all cell preparations , consistent with GH regulation of IGF 1 and IGFBP synthesis in multiple liver cell types . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Clinical review 112 : Does serum growth hormone ( GH ) binding protein reflect human GH receptor function . ^^^ Previous observations raised the possibility that circulating GH binding protein ( GHBP ) may serve as a useful index for tissue GH receptor ( GHR ) responsiveness in humans . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Differential influences of estrogens and androgens on the expression of the GH receptor gene and IGF 1 messenger RNA may be operative . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Preliminary results are also emerging on Pegvisomant , a genetically engineered GH receptor antagonist , which is clinically and biochemically very effective . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To address the side / mode of action through which GH exerts its effects , a panel of well characterized monoclonal antibodies , directed against the hormone binding side of the receptor , was applied to immunohistochemically determine growth hormone receptor ( GH receptor ) expression in poorly moderate to well differentiated col . orectal adenocarcinomas ( n = 40 ) from the rectum , transverse , ascending , descending and sigmoid colons . ^^^ Crypt base columnar cells strongly expressed the GH receptor , but oligomucous cells were less reactive . ^^^ It also raises questions regarding the administration of GH to cancer induced cachexia patients and the possible oncogenic potential of the GH receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Previous work from this laboratory has shown that the constant sc infusion of insulin like growth factor 1 ( IGF 1 ) to normal pituitary monkeys results in a sustained elevation in circulating concentrations of IGF binding protein 3 ( IGFBP 3 ) , whereas the acute administration of IGF 1 to monkeys pretreated with a GH receptor antagonist produces a brief , but significant , elevation in serum IGFBP 3 . ^^^ The present study tested the hypothesis that the constant infusion of IGF 1 would normalize serum concentrations of IGFBP 3 in females treated with the GH receptor antagonist . ^^^ Five female rhesus monkeys were studied over 21 consecutive days involving 7 days of baseline , 7 days of treatment with the GH receptor antagonist ( 1 . 0 mg / kg week , sc ) , and 7 days of treatment with the GH receptor antagonist supplemented with IGF 1 ( 120 microg / kg 10 day , sc infusion with osmotic minipump ) . ^^^ Within 48 h of the initiation of treatment with the GH receptor antagonist , serum IGF 1 and IGFBP 3 were decreased by 40 % and 18 % from baseline , respectively , and levels continued to decline through the remainder of treatment . ^^^ However , within 48 h of the initiation of IGF 1 administration during GH receptor antagonist treatment , both serum IGF 1 and IGFBP 3 were elevated and normalized to baseline values . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Hepatic GH receptor ( GHR ) peptide levels were not significantly altered by either alcohol or GH . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In non primate GHs , His ( 170 ) replaces the homologous Asp ( 171 ) , producing a repulsive interaction with Arg ( 43 ) of the primate receptor which was believed to reduce the attraction of non primate GH for the human GH receptor , thus providing species specificity . ^^^ In bovine GH addition of phenylalanine at position 44 increased the somatotrophic activity and receptor affinity in cells containing the human GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Ba / F3 cells transfected with the GH receptor ( GHR ) cDNA become able to proliferate in response to GH . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Regulation of human GH receptor gene transcription by 20 and 22 kDa GH in a human hepatoma cell line . ^^^ Because it has been reported that non 22 kDa GH isoforms might be partly responsible for short stature and growth retardation in children , the aim of this study was to compare the impact of both 22 kDa and 20 kDa GH on GH receptor gene ( GH receptor / GH binding protein ( GHR / GHBP ) ) expression . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Mouse myeloid leukaemia cells , which express the mouse GH receptor were used for the bioassay , and activation of these cells by GH was measured by a colorimetric microculture tetrazolium assay . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Hepatic inner ring deiodinating type 3 activity was markedly elevated , presumably as a consequence of low hepatic GH receptor numbers , and is thought to be the causal mechanism for the low plasma T 3 concentrations . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) independent dimerization of GH receptor by a leucine zipper results in constitutive activation . ^^^ Growth hormone ( GH ) independent dimerization of GH receptor by a leucine zipper results in constitutive activation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Immunohistochemistry and in situ hybridization analyses revealed a marked reduction in the expression of the IGF 1 receptor , as well as in the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH binding to its receptor recruits and activates the receptor associated JAK 2 that in turn phosphorylates tyrosines within itself and the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Characterisation of novel missense mutations in the GH receptor gene causing severe growth retardation . ^^^ They were shown to have unique missense mutations in the GH receptor gene . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The phenomenon that certain human lymphoid and monocytoid cell lines at different levels of cell differentiation are able to express the GH receptor gene could have importance in the rhGH therapy . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Flutamide administration decreased body weight gain , serum IGF 1 levels , hepatic IGF 1 mRNA , and GH receptor mRNA content . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Based on these data , we have studied the GH receptor ( GHR ) expression in acrochordons , seborrheic keratosis , melanocytic nevi , histiocytomas , squamous cell carcinomas , basal cell carcinomas , and malignant melanomas by means of the immunohistochemistry with the monoclonal antibody MAb 263 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Recurrence of sellar and suprasellar tumors in children treated with hGH relation to immunohistochemical study on GH receptor . ^^^ We retrospectively studied the immunohistochemical expression of the GH receptor in various tumor tissues , in order to investigate the relation between tumor recurrence and hGH replacement . ^^^ Immunohistochemical study of GH receptor in tumor tissue was carried out in those recurrent and recurrence free cases , by using MAb 263 as a primary antibody . ^^^ CONCLUSION : In the patients with craniopharyngioma treated with GH , a positive immunohistochemical expression of GH receptor in tumor tissue may indicate a high probability of recurrence . ^^^ In our cases , GH receptor was positive in astrocytomas and negative in germinomas , with or without recurrence . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Results suggested that rPRL and 20K hGH were acting on PRL receptor , but not on GH receptor , to prevent RSW induced gastric injuries . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH regulates the expression of GH receptor and the synthesis of insulin like growth factor 1 ( IGF 1 ) in adipocytes . ^^^ Hyperinsulinemia and increased GH receptor activity may also affect the GH IGF 1 axis . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These mutations have provided insight into the physiology of the GH receptor . ^^^ A few patients have been described with what appears to be primary GH insensitivity due to defective signal transduction by the GH GH receptor complex . ^^^ Except for those dominant negative mutations where co transfection of the mutant GH receptor gene with wild type receptor gene has been informative , evidence for an effect of a single mutant allele remains speculative . ^^^ Treatment of GH receptor deficiency with recombinant human IGF 1 suggests that the absence of a direct effect of GH limits growth response . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptor immunoreactivity is found throughout the gastrointestinal tract . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptor mRNA was also expressed by mesangial cells , independently of the GH concentration present in the cell culture medium . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptor deficiency leads to a marked decrease in circulating IGF 1 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The activated JAK 2 in turn phosphorylates tyrosines within itself and the associated GH receptor , forming high affinity binding sites for a variety of signaling molecules . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Corticosteroids in high doses reduced the expression of the GH receptor and type 1 IGF receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Some patients with growth hormone ( GH ) deficiency have mutations in the GH releasing hormone receptor or GH gene , whereas patients with GH insensitivity syndrome have mutations in the GH receptor or insulin like growth factor 1 gene . ^^^ It appears that heterozygous mutations of the GH receptor may cause partial GH insensitivity in a subset of patients with ISS . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Two alternatively spliced exon 9 variants of human GH receptor ( GHR ) messenger ribonucleic acid ( mRNA ) , GHR ( 1 279 ) and GHR ( 1 277 ) , were recently identified in liver . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A novel GH receptor antagonist ( pegvisomant ) binds to hepatic GH receptors and inhibits peripheral insulin like growth factor 1 generation . ^^^ Serum total IGF 1 levels were normalized in all six acromegalic patients previously shown to be resistant to somatostatin analogs via a novel mechanism of peripheral GH receptor antagonism . ^^^ The GH receptor antagonist is a useful treatment for patients harboring GH secreting tumors who are resistant to octreotide . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
After 14 days of acidosis and 7 days of treatment , growth rate , hepatic abundance of 4 . 7 kilobase ( kb ) and 1 . 2 kb GH receptor transcripts and 7 . 5 kb and 1 . 8 to 0 . 8 kb IGF 1 transcripts , serum GH binding protein ( GHBP ) , and IGF 1 concentrations ( mean+ / SEM ) were analyzed . ^^^ Significant decreases of 4 . 7 kb GH receptor [ 26+ / 2 vs . 49+ / 6 arbitrary densitometry units ( ADU ) ] and 7 . 5 kb IGF 1 ( 41+ / 3 vs . 104+ / 10 ADU ) transcripts and low serum GHBP ( 25+ / 1 vs . 32+ / 1 ng / ml ) and IGF 1 ( 279+ / 50 vs . 366+ / 6 nmol / l ) levels were found in the AC compared with the C rats . ^^^ GH treatment normalized the levels of IGF 1 mRNA , aggravated the acidosis related inhibition of the GH receptor gene , and did not modify the serum levels of GHBP and IGF 1 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In order to understand the interactions between glucocorticoids and functions of GH in HIP during acute stress , the mRNA levels for GH receptor ( GHR ) , glucocorticoid receptor ( GR ) and mineralocorticoid receptor ( MR ) were investigated in DG in rats exposed to restraint stress in the water ( RSW ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Liver expression of GH receptor mRNA was greater in C section pigs at birth ( P < 0 . 04 ) and 2 wk of age ( P < 0 . 03 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Interaction of GH with the cell surface GH receptor ( GHR ) causes activation of the GHR associated tyrosine kinase , JAK 2 , and consequent triggering of signaling cascades including the STAT , Ras / Raf / MEK1 / MAP kinase , and insulin receptor substrate 1 ( IRS 1 ) / PI3kinase pathways . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Preliminary studies have clearly demonstrated the effectiveness of the GH receptor antagonist in suppressing IGF 1 levels in acromegalic patients previously unresponsive to somatostatin analogues . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
As GH is now known to be produced in many extrapituitary sites , in which it acts in an autocrine or paracrine manner , the possibility that extra pituitary GH may participate in embryogenesis and organogenesis was assessed by determining the immunocytochemical presence and location of GH and GH receptor ( GHR ) like proteins in the peripheral tissues of chick embryos during their 21 day incubation period . ^^^ GH receptor immunoreactivity was also present in most tissues and cells of ED 3 ED8 embryos . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Cellular localisation of GH receptor in the bovine mammary gland during mammogenesis , lactation and involution . ^^^ We have used immunohistochemistry and non radioactive in situ hybridisation to localise the GH receptor and its transcript in the bovine mammary gland during mammogenesis , lactation and involution . ^^^ We found a characteristic pattern of immunoreactive GH ( irGH ) receptor distribution in the epithelial and stromal compartments during the different stages of mammary gland development : The ductular epithelium showed a distinct staining for irGH receptor during most stages , whereas the alveolar epithelium contained a modest amount of GH receptor during pregnancy which increased during lactation and galactopoiesis . ^^^ Curiously , the amount of GH receptor mRNA appeared relatively constant during mammogenesis and lactation . ^^^ Furthermore , the increased intensity of immunostaining in bovine mammary tissue post partum suggests a direct role for GH receptor in mediating the effect of GH in milk production and secretion . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Mutation of the SHP 2 binding site in growth hormone ( GH ) receptor prolongs GH promoted tyrosyl phosphorylation of GH receptor , JAK 2 , and STAT5B . ^^^ Binding of GH to GH receptor ( GHR ) rapidly and transiently activates multiple signal transduction pathways that contribute to the growth promoting and metabolic effects of GH . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Physiological plasma GH pulses are required to obtain the high levels of activated STAT5b seen in the livers of males , and down regulation of the GH receptor ( GHR ) JAK STAT5b pathway in hepatocytes exposed to GH in a near continuous fashion underlies the low level of liver STAT5b activity that is characteristic of adult female rats . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The molecular mechanisms involved are unclear , although an effect of cytokines on GH receptor signalling has been suggested . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We studied GH receptor ( GHR ) gene in children who show poor response to GH treatment and detected a patient with a heterozygous mutation in exon 7 leading to the Y222H substitution . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In the liver , the messenger RNA ( mRNA ) expressions both for GH receptor ( GHR ) and IGF 1 were significantly repressed by PTU treatment , and were restored again by T 4 replacement . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The high affinity growth hormone binding protein ( GHBP ) in human serum derives from the extracellular domain of the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
IGF 1 and GH receptor mRNA were measured in the kidney and the liver of the surviving animals at the end of the experiment . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of GH receptor , IGF 1 receptor and IGF 1 mRNA in the kidney and liver of rats recovering from unilateral renal ischemia . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) inducible suppressors of cytokine signaling ( SOCS / CIS proteins ) inhibit GH receptor ( GHR ) signaling to STAT5b via phosphotyrosine dependent binding interactions with the tyrosine kinase JAK 2 ( SOCS 1 ) and / or the cytoplasmic tail of GHR ( CIS and SOCS 3 ) . ^^^ Growth hormone ( GH ) inducible suppressors of cytokine signaling ( SOCS / CIS proteins ) inhibit GH receptor ( GHR ) signaling to STAT5b via phosphotyrosine dependent binding interactions with the tyrosine kinase JAK 2 ( SOCS 1 ) and / or the cytoplasmic tail of GHR ( CIS and SOCS 3 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This is shown by reduced systemic IGF and IGFBP 3 levels in osteoporosis suggesting a decrease of endogenous GH secretion or a dysregulation of the GH receptor system which is beyond the normal ageing process of the GH / IGF system , the `` somatopause ' ' . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In this study the regulation of GH receptor gene ( GHR / GHBP ) transcription by different concentrations of GH ( 0 , 12 . 5 , 25 , 50 , 150 , 500 ng / ml ) with and without variable TSH concentrations ( 0 . 5 , 2 , 20 mU / l ) in primary human thyroid cells cultured in serum free hormonally defined medium was studied . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The physiological effects of insulin like growth factor 1 ( IGF 1 ) on intermediate metabolism of substrates have been extensively studied in a variety of experimental situations in man , and its effects on linear growth of children with GH receptor mutations have proven beneficial . ^^^ However , there is a paucity of data on the metabolic effects of IGF 1 as replacement therapy in adults with GH receptor deficiency ( Laron ' s syndrome ) . ^^^ We designed these studies to investigate the in vivo effects of 8 weeks of therapy with recombinant human IGF 1 ( rhIGF 1 ) in a unique group of 10 adult subjects with profound IGF 1 deficiency due to a mutation in the GH receptor gene ( mean + / SEM age , 29 . 2 + / 2 . 0 yr ; 4 males and 6 females ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH receptor and GH are both expressed in peripheral blood mononuclear cells ( PBMCs ) ; thus , GH could act as either an endocrine or an autocrine modulator of the immune response . ^^^ We considered the possibility that endogenous GH production by PBMCs could influence the cytokine response in activated PBMCs ; however , incubation of PBMCs in the presence of the GH receptor antagonist , B 2036 , had no effect on TNFalpha , IL 6 , or IFNgamma production by PBMCs in either the mixed lymphocyte reaction or when activated by endotoxin . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) , GH receptor , and signal transduction . ^^^ Growth hormone ( GH ) , GH receptor , and signal transduction . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We found that GH receptor ( GHr ) binding was comparable in fetal liver and adult liver . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In 1993 , GH receptor ( GHR ) was first observed to bind to the tyrosine kinase JAK 2 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The lower plane of nutrition decreased the expression of the ALS , IGF 1 , and GH receptor genes and increased the expression of the IGFBP 2 gene ; expression of the IGFBP 3 gene was not affected by nutrition at this stage of life . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The effects of growth hormone ( GH ) in regulating the expression of the hepatic and renal GH and insulin like growth factor ( IGF ) system were studied by administering a novel GH receptor antagonist ( GHRA ) ( B 2036 PEG ) at different doses ( 0 , 1 . 25 , 2 . 5 , 5 and 10 mg / kg / day ) to mice for 7 days . ^^^ Hepatic GH receptor ( GHR ) and GH binding protein ( GHBP ) mRNA levels increased significantly in all GHRA dosage groups . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) regulates both bone growth and remodeling , but it is unclear whether these actions are mediated directly by the GH receptor ( GHR ) and / or IGF 1 signaling . ^^^ Growth hormone ( GH ) regulates both bone growth and remodeling , but it is unclear whether these actions are mediated directly by the GH receptor ( GHR ) and / or IGF 1 signaling . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
An explanation for the luteotropic effect of PL and the lack of this effect for GH is that the GH receptor associates with a different molecule within the ovarian tissue and forms a heterodimeric receptor for PL , and the possibility that physiological effects of native oPL may be mediated through its binding to specific PL receptors , which have low affinities for oGH and oPRL . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The UMR 106 cell line is a rat clonal osteosarcoma cell line with osteoblast like phenotypic properties , one is the endogenous expression of GH receptor ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Human GH receptor ( hGHR ) was recently expressed on a Ba / F3 cell line , which is a mouse pro B cell lymphoma that has been induced to become a cloned cell line ( Ba / F3 hGHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To test the hypothesis that hypothalamic GH receptors are involved in the ultradian rhythmicity of pituitary GH secretion , the rat GH receptor antagonist ( G118R ) was administered to adult male rats by intracerebroventricular ( i . c . v . ) injection and the effects on spontaneous GH secretion were studied . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Tumor necrosis factor alpha converting enzyme ( TACE ) is a growth hormone binding protein ( GHBP ) sheddase : the metalloprotease TACE / ADAM 17 is critical for ( PMA induced ) GH receptor proteolysis and GHBP generation . ^^^ The GH binding protein ( GHBP ) , which exists in many vertebrates , is a circulating high affinity binding protein corresponding to the extracellular domain of the GH receptor ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Small pigs had lower levels of liver ALS ( P = 0 . 0003 ) , muscle IGF 2 ( P = 0 . 02 ) , and muscle GH receptor ( P = 0 . 006 ) mRNAs . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This suggests that in sepsis ' GH resistance ' is not associated with reduced GH receptor numbers . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To examine the relationship between growth hormone ( GH ) and insulin like growth factor 1 ( IGF 1 ) in controlling postnatal growth , we performed a comparative analysis of dwarfing phenotypes manifested in mouse mutants lacking GH receptor , IGF 1 , or both . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To assess the relevance of the GH receptor ( GHR ) in the mammary gland , we transplanted GHR null epithelium into cleared fat pads of wild type mice . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The expression of the IGF family and GH receptor in the bovine mammary gland . ^^^ To study the involvement of the IGFs in mammary development and lactation of the cow , the temporal expressions of IGF 1 and 2 , its receptor type 1 ( IGFR 1 ) , IGF binding proteins ( IGFBPs ) 1 to 6 and GH receptor ( GHR ) mRNA were examined . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Dependence of murine pro B Ba / F3 cells on interleukin 3 can be substituted by GH when cells are stably transfected with the GH receptor ( GHR ) complementary DNA . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Such effects of GH were prevented in the presence of the specific GH receptor antagonists B 2036 and G120K . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Although it is presently well established that locally produced growth hormone ( GH ) plays a major role in the regulation of survival mechanisms in hemopoietic cells , the responsible mechanisms are poorly understood , and the involvement of the GH receptor ( GHR ) has not even been demonstrated to date . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We describe the case of an acromegalic subject , who was the first patient ever treated with the GH receptor antagonist pegvisomant . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In skeletal muscle inverse changes were seen in the expression of messenger ribonucleic acid ( mRNA ) levels for the two GH receptor forms : expression of GHR increased significantly , whereas mRNA levels for GHRtr decreased . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Similarly , hepatic GH receptor mRNA levels were significantly reduced in PHx animals . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Moreover , in the CRF group , especially in the younger children , low levels of IGF 1 and IGFBP 3 are evocative of an associated resistance at the GH receptor level . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The technique of 5 ' rapid amplification of cDNA ends ( RACE ) was employed to identify potentially novel 5 ' UTRs for the GH receptor gene . ^^^ Northern blot analysis indicated that two bands of sizes congruent with4 . 8 kb , corresponding to GH receptor mRNA , and congruent with1 . 5 kb corresponding to GH binding protein mRNA , were detectable in liver , skeletal muscle , kidney and heart but not in brain , spleen , lung or testis . ^^^ Fluorescent 5 ' nuclease real time RT PCR based analysis indicated that in the placenta and fetal liver , the L 5 transcript represented 10 15 % of the GH receptor transcripts . ^^^ In the adult liver , heart and kidney , the L 5 transcript is less abundant accounting for 1 5 % of the total GH receptor transcripts . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The availability of assays for the determination of GHBP isoforms may be very important for the study of the GH receptor and its soluble extracellular domain , GHBP . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Human GRB 10 on chromosome 7 , a homologue of the mouse imprinted gene Grb 10 , is a candidate , because GRB 10 has a suppressive effect on growth , through its interaction with either the IGF 1 receptor or the GH receptor , and two patients with RSS were shown to have a maternally derived duplication of 7p11 p 13 , encompassing GRB 10 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Phorbol ester and growth factor induced growth hormone ( GH ) receptor proteolysis and GH binding protein shedding : relationship to GH receptor down regulation . ^^^ GH signals by interacting with GH receptor ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A RT PCR analysis revealed that mRNA for GH receptor in CL was fully expressed from early in the luteal phase throughout the estrous cycle , while luteinizing hormone ( LH ) receptor mRNA was expressed less by the early and regressing CL than those at mid or late luteal phases ( P < 0 . 05 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These studies were performed to evaluate the efficacy of GH receptor blockade in vivo . ^^^ One animal from each of the 15 pairs was then treated with the GH receptor antagonist pegvisomant and the other with vehicle alone for 8 weeks . ^^^ Because the authors have previously demonstrated that the GH receptor is ubiquitously expressed in meningiomas , direct blockade of the GH receptor on the tumors may also be contributing to inhibitory actions . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Lastly , compounds with a novel mechanism of action , the GH receptor antagonists , are presently under investigation . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These studies indicate that PI3K / Akt / GSK 3 mediates signaling between GH receptor and the nucleus , promoting dephosphorylation of C / EBPbeta . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH receptor antagonist , B 2036 PEG , has been developed for treating acromegaly . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These different types of pituitary dwarfism can be classified on the level of the defect ; mode of inheritance ; whether the phenotype is isolated growth hormone deficiency ( IGHD ) or combined pituitary hormone deficiency ( CPHD ) ; whether the hormone is absent , deficient , or abnormal ; and , in patients with GH resistance , whether insulin like growth factor 1 ( IGF 1 ) is deficient due to GH receptor or IGF 1 defects . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Treatment with lactogenic hormones enhanced GH receptor ( GHR ) transcription that was determined by RT PCR . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Using Chinese hamster ovary ( CHO ) cell lines stably transfected either with the full length human GH receptor ( hGHR ) or with the cytoplasmic domain truncated hGHR ( hGHR ( tr ) ) , we show that the phorbol ester , phorbol 12 myristate 13 acetate ( PMA ) , caused a rapid time and dose dependent increase in GHBP secretion , which , as expected , was matched by a corresponding decrease in cell surface GHR . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Here , we have investigated the impact of nutrition and GH treatment on GH receptor , SOCS 1 , SOCS 2 , SOCS 3 and cytokine inducible SH 2 containing protein ( CIS ) hepatic mRNA expression in a rat model of sepsis , caecal ligation and puncture ( CLP ) . ^^^ GH receptor and GH binding protein expression in liver was reduced in animals subjected to CLP and was unaffected by nutrition or GH treatment . ^^^ In conclusion , CLP induced low IGF 1 levels associated with increased expression of SOCS 1 and SOCS 3 , both of which are known to inhibit GH receptor signalling . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Previous studies have identified eight variant human GH receptor ( hGHR ) messenger RNA ( mRNAs ; V 1 V8 ) , that differ in their 5 ' untranslated regions ( 5 ' UTRs ) but splice into the same site just upstream of the translation start site in exon 2 ; thus , they encode the same protein . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The decrease in hepatic IGF 1 gene expression in arthritic rats is not associated with modifications in hepatic GH receptor mRNA . ^^^ GH receptor ( GHR ) gene expression in the liver and the effect of rhGH on hepatic IGF 1 synthesis in arthritic rats were examined . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A substantial proportion of GH circulates bound to high affinity GH binding protein ( GHBP ) , which corresponds to the extracellular domain of the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Cellular activities of 20K and 22K hGH do not necessarily correlate with their binding affinities for rat GH receptor . ^^^ In order to investigate the reason why such controversial data exist , we have studied 20K and 22K hGH using the rat GH receptor extracellular domain ( rGHR ECD ) and full length rGHR . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The widespread distribution of GH IR in the neural tissues of ED 3 embryos was mirrored by the distribution of GH receptor ( GHR ) immunoreactivity , detected by an antibody raised against the chicken GHR . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH receptor 1A mRNA ( GHR 1A mRNA ) is one of the major GHR mRNA variants that differ in the 5 ' untranslated region . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Circulating concentrations of the high affinity growth hormone binding protein ( GHBP ) may be a marker of GH receptor density as well as GH sensitivity . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Furthermore , the expression vector for the GH receptor also activated the ADH promoter , and this effect was abrogated by mutations of the adjacent STAT5b and C / EBP beta binding sites . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Ba / F3 cells expressing the rat GH receptor ( Ba / F3 GHR cells ) have been shown to escape from apoptosis and to proliferate under GH stimulation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
However , using the mouse myeloid cell line FDC P 1 transfected with the full length ovine GH receptor ( GHR ) , we subsequently found that OA 11 and OA 14 remained inhibitory with respect to the end point measurement of GH stimulated mitogenesis but that OA 15 had no inhibitory effect on GH stimulated mitogenesis in this cell line . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Testicular endocrine function in GH receptor gene disrupted mice . ^^^ The consequences of disruption of GH receptor gene in GH receptor knockout mice on testicular function were evaluated . ^^^ Adult male GH receptor knockout mice and their normal siblings were divided in to two subgroups and treated with either saline or ovine LH ( 0 . 3 microg / g BW ) in saline . ^^^ Unlike in normal , wild type mice , the circulating IGF 1 was undetectable in GH receptor knockout mice . ^^^ The plasma PRL levels were ( P < 0 . 01 ) higher in GH receptor knockout mice than in their normal siblings . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Liver GH receptor ( GHR ) and GH binding protein ( GHBP ) mRNA levels , as well as liver membrane GH binding assays were deeply decreased in the 30d DM group in comparison to controls . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Initial analysis for mRNA expression demonstrated the following : GH receptor ( 5 / 5 cell lines positive ) , IGF 1 ( 0 / 5 ) , IGF 2 ( 0 / 5 ) , IGF 1 receptor ( 5 / 5 ) , IGF 2 receptor ( 2 / 5 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Hepatic GH receptor ( GHR ) mRNA levels were significantly decreased in CRF , but GHR protein abundance and GH binding to microsomal and plasma membranes was unaltered . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Abnormal GH receptor signaling in children with idiopathic short stature . ^^^ In particular , we measured GH receptor transducing properties through GH induced protein tyrosine phosphorylation in patients ' peripheral blood mononuclear cells and performed direct sequencing analysis of GH receptor coding exons . ^^^ Sequence analysis of the GH receptor gene revealed a heterozygous mutation resulting in an Arg to Cys change ( R161C ) in exon 6 in only 1 patient , who had normal GH receptor responsiveness . ^^^ Our findings indicate that abnormal GH receptor signaling may underlie idiopathic short stature even in the absence of GH receptor mutations . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To determine whether GH / IGF 1 modulates the development and growth rate of GHRH induced pituitary tumors , pituitary growth and histology were evaluated in mice generated from cross breeding metallothionein promoter driven hGHRH transgenic mice with GH receptor binding protein ( GHR ) gene disrupted mice ( GHR ( / ) ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH induced the expression of liver Igf 1 mRNA in hypophysectomized male wild type , but not in hypophysectomized male Stat5b ( / ) mice , although the Stat5b ( / ) mice exhibit both normal liver GH receptor expression and strong GH induction of Cytokine inducible SH 2 protein ( Cis ) , which is believed to contribute to the down regulation of GH induced liver STAT5b signaling . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We therefore tested the C2C12 myogenic cell line for its response to GH and demonstrate that C2C12 skeletal muscle cells rapidly respond to physiological levels of GH with increased tyrosine phosphorylation of the GH receptor , Janus kinase 2 , signal transducer and activator of transcription 5a and 5b , insulin receptor substrate 1 , and activation of MAPKs / ERKs and protein kinase B / Akt . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These cells expressed both the GH receptor and the IGF 1 gene , as demonstrated using a ribonuclease protection assay . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Pegvisomant is a GH receptor antagonist that inhibits GH receptor dimerization and has a powerful ability to lower serum IGF 1 levels in patients with active acromegaly . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Furthermore , new data obtained in knock out ( KO ) mice with GH receptor ( GHR ) / GH binding protein ( GHBP ) gene disruption have shown that these animals are protected against diabetes induced renal changes . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Pegvisomant is a recombinant protein , structurally similar to natural human growth hormone ( GH ) , which is capable of binding to the GH receptor as a competitive antagonist . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
An abrupt rise in circulating GH concentration stimulates rapid internalization of the GH receptor in peripheral target tissues , and evokes second messenger nuclear signalling via the STAT 5b pathway . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In the treatment of active acromegaly with the GH receptor antagonist pegvisomant , ALS showed a closer correlation with the change in ring size , measured as a clinical indicator of disease activity , than did IGF 1 or IGFBP 3 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH , GH receptor , GH secretagogue receptor , and ghrelin expression in human T cells , B cells , and neutrophils . ^^^ We examined GH and GH receptor expression in human leukemic cell lines and leukocytes of normal subjects to elucidate the cell types expressing GH and GH receptor , the individual variations of their expressions , their correlation and the relationships with serum IgG and IGF 1 concentrations . ^^^ GH receptor mRNA expression was detectable in all human leukemic cell lines , although the expression level varied widely among the cell lines and was weaker than that in the liver . ^^^ On the other hand , GH receptor mRNA expression was mainly found in B cells , with marked individual variation in normal subjects . ^^^ There was a positive correlation between the mRNA expressions of GH and GH receptor in B cells of normal subjects ( r = 0 . 89 ; P < 0 . 001 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We hypothesized that some children with idiopathic short stature in Chile might bear heterozygous mutations of the GH receptor . ^^^ Coding sequences and intron exon boundaries of exons 2 10 of GH receptor gene were amplified by PCR and subsequently analyzed through single strand conformational analysis . ^^^ The single strand conformational analysis of the GH receptor gene showed abnormal migration for exon 6 in 9 patients and for exon 10 in 9 patients , which ( by sequence analysis ) corresponded to 2 polymorphisms of the GH receptor gene : an A to G transition in third position of codon 168 in exon 6 and a C to A transversion in the first position of codon 526 in exon 10 . ^^^ In conclusion , the results of our study suggest that , in Chilean patients with idiopathic short stature , GH receptor gene mutations are uncommon , although we can not exclude mutations that were missed by single strand conformational analysis or mutations within introns or in the promoter regions of the GH receptor gene . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Peripheral blood mononuclear cells were isolated and RNA for GH receptor ( GHR ) , IGF 1 receptor ( IGF IR ) and thyroid hormone receptor ( TRalpha 1 ) was amplified by RT PCR . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Finally , because most of the GH released after exercise was able to dimerize the GH receptor in vitro , it is also concluded that these forms have the two intact binding sites required to initiate signal transduction in target cells . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In HepG 2 cells transiently cotransfected with either the long form of the rat PRL receptor or rat GH receptor , signal transducer and activator of transcription 5a and a 5 responsive luciferase expression vector containing the Na ( + ) / taurocholate cotransporting polypeptide promoter , mouse placental lactogen 1 , like ovine PRL , activated 5a via the long form of the rat PRL receptor ; whereas rat GH activated 5a via rat GH receptor , leading to transactivation of the Na ( + ) / taurocholate cotransporting polypeptide promoter . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
METHODS : To describe growth in human and animal models of isolated IGF 1 deficiency ( IGHD ) , such as in Laron syndrome ( LS ; primary IGF 1 deficiency and GH resistance ) and IGF 1 gene or GH receptor gene knockout ( KO ) mice . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
BACKGROUND / OBJECTIVE : Pegvisomant is a pegylated analogue of human GH and functions as a potent GH receptor antagonist . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The elucidation of the mechanisms by which growth hormone ( GH ) interacts with its receptor has facilitated the design of compounds that function as GH receptor antagonists . ^^^ This article describes the mechanism of action of GH receptor antagonists , reviews the preclinical and clinical data on the use of pegvisomant and discusses some of the challenges that lie ahead in judging the efficacy of a treatment that , unlike established therapies for acromegaly , does not aim to modify the underlying cause of acromegaly , namely excess GH secretion , but aims to lower serum IGF 1 levels to normal . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Activation of the GH receptor system is relatively transient , with several mechanisms being involved in down regulation : internalization and degradation of the receptor and recruitment of phosphatases or specific inhibitors of the Jak Stat pathway , the suppressors of cytokine signalling ( SOCS ) proteins . ^^^ Finally , the use of the GH receptor knock out mouse model has allowed us to dissect the role of this hormone in post natal body growth and homeostasis . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Overlap with idiopathic short stature ( ISS ) exists , with heterozygous mutations of the GH receptor demonstrated to cause impaired growth . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The concept of growth hormone ( GH ) insensitivity has evolved since the condition was originally identified in 1966 , and we now know that the primary defect involved is in the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Recent studies produced some evidence that GH receptor is expressed in ovarian tissue , implying a direct role for GH in the ovary . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GHBP is identical to the extracellular part of the hepatic GH receptor , but other tissues may contribute to the circulating GHBP levels . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We therefore determined content of mRNA transcripts ( by RT PCR ) for GH receptor ( GHR ) , IGF 1 , androgen receptor ( AR ) , and myostatin in skeletal muscle biopsy samples from 27 healthy men > 65 yr of age . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We investigated in healthy nonobese males the effect of the GH receptor antagonist pegvisomant in different metabolic conditions . ^^^ In conclusion , in different metabolic conditions the GH receptor antagonist pegvisomant induces no significant acute changes in the major risk markers for cardiovascular disease . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
One hundred and ninety eight subjects [ including normal subjects ; subjects with GHI , GH deficiency ( GHD ) , and idiopathic short stature ( ISS ) ; and heterozygotes for the E 180 splice GH receptor mutation ] were randomized to self administration of either a high ( 0 . 05 mg / kg 10 d ) or a low ( 0 . 025 mg / kg 10 d ) dose of GH for 7 d . ^^^ Subjects heterozygous for the E 180 GH receptor splice mutation did not show a decreased responsiveness to GH . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Subsequently , we studied 30 healthy persons and 25 GH deficient ( GHD ) patients randomized to treatment with GH or placebo in a double blinded manner , and further included samples from 23 patients with active acromegaly examined before and after treatment with octreotide or the GH receptor antagonist pegvisomant for 3 months . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Western blotting determined the molecular size of immunoreactive GH in RPE cells to be 80 84 kDa , similar to the computed molecular mass of s cGH / GH receptor complex . ^^^ Furthermore , RT PCR demonstrated that GH receptor mRNA , but not s cGH mRNA , was expressed in RPE cells . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone binding protein ( GHBP ) corresponds to the extracellular domain of the GH receptor and is closely related to measures of body composition and , specifically , to size of visceral fat tissue . ^^^ Leptin , the adipocyte specific ( ob ) gene product , has been proposed as the signal linking adipose tissue and GHBP / GH receptor expression . ^^^ Leptin could be the signalling link between adipose tissue and GHBP / GH receptor expression in CHF . . ^^^ Growth hormone binding protein ( GHBP ) corresponds to the extracellular domain of the GH receptor and is closely related to measures of body composition and , specifically , to size of visceral fat tissue . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Interaction of GH with its cell surface GH receptor ( GHR ) , by virtue of receptor dimerization , causes activation of the GHR associated cytoplasmic tyrosine kinase , JAK 2 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A 68 year old patient with Laron syndrome ( primary growth hormone ( GH ) resistance insensitivity due to a molecular defect of the GH receptor ) and severe obstructive sleep apnoea syndrome is described . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Thyroid hormones and the mRNA of the GH receptor and IGFs in skeletal muscle of fetal sheep . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The ligand engaged GH receptor ( GHR ) and erythropoietin receptor ( EpoR ) extracellular domains are believed to exist in a dimerized configuration in which a single ligand molecule engages two receptor extracellular domains . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Their effects are mediated via binding to GH receptor ( GHR ) and IGF 1 receptor ( IGF IR ) in target tissues . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH receptor antagonist pegvisomant is a genetically engineered analogue of GH that prevents functional dimerisation of the growth hormone receptor ( GHR ) ; a process that is critical to GH action at the cellular level . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Release of soluble growth hormone binding protein ( GHBP ) corresponding to the extracellular domain of the GH receptor ( GHR ) occurs via distinct mechanisms depending on species . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The effects of continuous high GH levels on GH signal transduction through the GH receptor ( GHR ) / Janus kinase 2 ( JAK 2 ) / signal transducer and activator of transcription 5 ( STAT 5 ) pathway as well as the desensitization of this pathway by suppressors of cytokine signaling ( SOCS ) were studied in transgenic mice overexpressing GHRH . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH stimulated tyrosine phosphorylation of the GH receptor , signal transducer and activator of transcription 3 ( Stat 3 ) , and Stat 5 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
DESIGN AND SUBJECTS : In ten healthy non obese males we performed a double blind placebo controlled crossover study comparing fasting with and fasting without GH receptor blockade . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
It has previously been shown that the large increase in GH binding capacity of mouse liver microsomes during pregnancy is due largely to an increase in the amount of GH binding protein ( GHBP ) , with a more modest increase in GH receptor ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Poor reproducibility of IGF 1 and IGF binding protein 3 generation test in children with short stature and normal coding region of the GH receptor gene . ^^^ To assess the reproducibility of the generation test , we studied a group of 12 prepubertal children with short stature and normal GH secretion in whom defects in coding region of GH receptor gene were ruled out . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In GHI , mutations of the GH receptor gene result in a phenotype similar to GHD , with increased adiposity and unfavorable lipid profiles . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Animal models of genetic MPHD ( Ames and Snell mice ) and GH receptor knockout mice ( primary IGF 1 deficiency ) also have a statistically significant higher longevity compared to normal controls . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The liver expression of insulin like growth factor 1 ( IGF 1 ) , GH receptor ( GHR ) , and suppresor of cytokine signaling ( SOCS ) 3 mRNA were detected by reverse transcriptase polymerase cha in reaction , the GH levels were measured by radioimmunoassay , the levels of tumor necrosis factor alpha ( TNF alpha ) and interleukin 6 ( IL 6 ) were detected by enzyme linked immunosorbent assay . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Impairment of liver GH receptor signaling by fasting . ^^^ Similarly , the phosphorylation of the GH receptor , although observed in both fasted and fed rats after GH injection , was markedly reduced in fasted rats . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
LPS decreased hepatic GH receptor ( GHR ) and IGF 1 mRNA only in Wistar rats . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Thirdly , employing transfection experiments in GH receptor positive CHO cells with P 2 and P 4 promoter luciferase constructs , an upregulation by GH was evident , while a P 1 promoter construct was unresponsive . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) may act as a local growth factor in early embryonic development , since GH and GH receptor ( GHR ) immunoreactivity is present in all tissues and most cells of embryonic chicks during organogenesis . ^^^ Growth hormone ( GH ) may act as a local growth factor in early embryonic development , since GH and GH receptor ( GHR ) immunoreactivity is present in all tissues and most cells of embryonic chicks during organogenesis . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Mutations of the GH receptor ( GHR ) have been reported in a few children with apparent idiopathic short stature ( ISS ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The ubiquitin proteasome pathway regulates the availability of the GH receptor . ^^^ The multiple actions of GH start when GH binds to the cell surface expressed GH receptor . ^^^ In this study , we examined the role of the ubiquitin proteasome pathway in regulating GH receptor availability . ^^^ We show that receptor turnover is rapid , and almost 3 fold prolonged in the internalization deficient mutant GH receptor ( F327A ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Lymphoid cells express the GH receptor , which belongs to the cytokine receptor superfamily , and GH can be produced by immune tissues , suggesting an autocrine / paracrine mode of action of GH . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Effect of different growth hormone ( GH ) mutants on the regulation of GH receptor gene transcription in a human hepatoma cell line . ^^^ The aim of this study was to assess the bioactivity of this R183H mutant GH in comparison with both other GH variants and the 22 kDa GH in terms of GH receptor gene regulation . ^^^ DESIGN AND METHODS : The regulation of the GH receptor gene ( GH receptor / GH binding protein , GHR / GHBP ) transcription following the addition of variable concentrations ( 0 , 12 . 5 , 25 , 50 and 500 ng / ml ) of R183H mutant GH was studied in a human hepatoma cell line ( HuH 7 ) cultured in a serum free hormonally defined medium . ^^^ In addition , identical experiments were performed using either recombinant human GH ( 22 kDa GH ) as a positive control or two GH receptor antagonists ( R77C mutant GH and pegvisomant ( B 2036 PEG ) ) as negative controls . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The presence of growth hormone ( GH ) binding sites and GH receptor ( GHR ) immunoreactive proteins in the brain suggests it is a target site for GH action . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH receptor antagonist , pegvisomant , reduces IGF 1 levels in 98 % of patients treated . ^^^ We investigated the effects of GH receptor blockade on inflammatory and other cardiovascular risk markers in active acromegaly . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Pegvisomant is a novel pegylated GH analog that competes with wild type GH for GH receptor binding sites but contains a position 120 , amino acid substitution that prevents functional GH receptor dimerization , a known prerequisite for GH signal transduction and generation of IGF 1 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The purpose of this study was to investigate the effect of serum IGF 1 normalization on serum lipoproteins and insulin , in patients with acromegaly receiving the GH receptor antagonist pegvisomant . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Immunohistochemical localisation of growth hormone ( GH ) , GH receptor ( GHR ) , insulin like growth factor 1 ( IGF 1 ) and type 1 IGF 1 receptor , and gene expression of GH and GHR in rat pre antral follicles . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
RESULTS : Both cell lines expressed GH receptor mRNA . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
It is hypothesized that in ISS an alteration of the signal transduction pathway between the GH receptor and IGFBP 3 synthesis results in a local imbalance with high IGFBP 3 levels and lower IGF 1 availability for the IGF 1 receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH induced effects on the expression of hippocampal gene transcripts of GH receptor ( GHR ) and GH binding protein were also examined . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
An immunoprecipitation method , in which plasma GHBP was rendered polyethylene glycol precipitable with a monoclonal antibody to the rabbit GHBP / GH receptor ( MAb 43 ) and labelled with ( 125 ) 1 hGH , was used to quantitate plasma GHBP by Scatchard analysis in the developing ( pooled plasma samples ) and adult ( individual animals ) possums . ^^^ Therefore , in early pouch life when plasma GH concentrations are highest , the very low concentrations of GHBP are unlikely to be important in terms of competing with GH receptor for ligand or altering the half life of circulating GH . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The exogenous expression of the GH receptor in one family of LS fibroblasts ( H 1 ) but not the other ( M ) restores signaling to a STAT 5 reporter element . ^^^ Together , these results indicate that the mechanism of defective GH signaling in two families of LS fibroblasts are different but that both occur at a level close to , and specific for , the GH receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Results of ribonuclease protection assays showed increased expression of hepatic mRNA for GH receptor 1A and IGF 1 with increased intake . ^^^ The amounts of GH receptor and IGF 1 mRNA in muscle and adipose , however , were not affected by intake . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The Spontaneous Dwarf rat ( SDR ) arose from the Sprague Dawley rat and harbors a mutation in its GH gene yielding undetectable levels of a severely truncated protein not capable of binding to the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
METHODS : The author discusses the characteristics and indications of pegvisomant therapy for patients with acromegaly and compares the use of this newly developed GH receptor antagonist with other pharmacological agents such as somatostatin and dopamine agonists . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Pegvisomant , a polyethylene glycol ( PEG ) derivative of human growth hormone ( GH ) that acts as a highly selective GH receptor antagonist , is under development by Pharmacia ( formerly Sensus ) as a potential treatment for acromegaly . ^^^ By 1994 , Sensus had licensed technology for development of GH receptor antagonists from Genentech and Ohio University . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The regulatory effect of growth hormone ( GH ) on its target cells is mediated via the GH receptor ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Eleven patients ( four females and seven males aged 10 49 yr ) had defects of the GH receptor ( Laron syndrome ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The present study suggests that regulation of GH receptor ( GHR ) levels in rat hepatoma cells by repeated GH stimulation determines GH responsiveness via the JAK2 / STAT5 pathway . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
It is unclear whether hyposomatotropism in abdominally obese humans is compensated by up regulation of GH receptor sensitivity or causes less biological effect in target tissues . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The dual effector theory suggests that GH would act primarily on the `` stem cells . ' ' However , staining with a GH receptor ( GHR ) antibody is found in all layers of the growth plate in rabbits and humans . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Liver from septic rats demonstrated a 50 % reduction in GH receptor ( GHR ) and IGF 1 mRNA on day 5 that was attenuated by TNFbp . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have now demonstrated the co expression of GH and GH receptor ( GHR ) mRNA isoforms in the ALVA 41 , PC 3 , DU 145 , LNCaP prostate cancer cells by reverse transcription polymerase chain reaction . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Pituitary GH mRNA was measured by Northern blot , and liver GH receptor and insulin like growth factor 1 mRNAs by RNAase protection . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Evaluation of the protein tyrosine phosphorylation events occurring following either T cell receptor ( TCR ) or GH receptor ( GHR ) triggering revealed striking abnormalities . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Laron syndrome ( LS ) or growth hormone ( GH ) insensitivity syndrome ( GHIS ) is an autosomal recessive disease due to molecular defects in the GH receptor gene ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Their molecular defect consists of inclusion of a mutant intronic pseudoexon in the region of the GH receptor involved in homodimerization . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In patients with acromegaly who are treated with a GH receptor antagonist , selective blockade of the GH receptor results in a decrease in circulating IGF 1 levels in the majority of cases . ^^^ DESIGN AND SUBJECTS : Twenty seven patients with acromegaly were enrolled as part of a multicentre 12 week trial of a GH receptor antagonist and were randomized to placebo ( n = 7 ) or 10 , 15 or 20 mg of pegvisomant ( n = 20 ) . ^^^ CONCLUSIONS : Using a specific GH receptor antagonist , we found that normalization of IGF 1 is associated with rapid reductions in markers of both bone formation and resorption , and that these processes remain coupled . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The metzincin metalloproteinase , tumor necrosis factor alpha converting enzyme ( TACE ) , also known as ADAM ( a disintegrin and metalloproteinase ) 17 , has recently been identified as an important enzyme for cleavage of the GH receptor ( GHR ) and shedding of GH binding protein ( GHBP ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These findings indicate that a GH receptor system in cancellous bones could operate in mutant mice . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The overexpressed SOCS 2 was found to bind to endogenous GH receptors in a number of mouse organs , while phosphopeptide binding studies with recombinant SOCS 2 defined phosphorylated tyrosine 595 on the GH receptor as the site of interaction . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In contrast , hCS does not activate signaling in these GH receptor expressing cells . ^^^ These results provide preliminary evidence that GH 5 plays a major role in affecting target cells expressing the GH receptor , thus potentially exerting significant GH like effects on maternal physiology during pregnancy . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This study was conducted to determine whether administration of a GH receptor antagonist to patients with acromegaly and insulin resistance would result in improvement in insulin sensitivity and whether IGF 1 had any additional insulin sensitizing effects over and above those induced by its ability to suppress GH secretion . ^^^ Five patients with active acromegaly were treated for 2 wk with a GH receptor antagonist . ^^^ The GH receptor antagonist was effective , as IGF 1 fell 65 % , and mean GH values rose 42 % . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This acute effect of endotoxin corresponded temporally with transient induction of suppressor of cytokine signaling ( SOCS ) 3 , cytokine inducible SH 2 containing protein ( CIS ) , phosphoenolpyruvate carboxykinase ( PEPCK ) , and insulin like growth factor binding protein ( IGFBP ) 1 and suppression of GH receptor ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
METHODS : To elucidate a possible direct role for GH in HP induced renal growth , we examined the effect of a newly developed specific GH receptor ( GHR ) antagonist ( B 2036 PEG ) on renal growth and renal GH / IGF system expression in HP fed mice . ^^^ GH receptor antagonist ( GHRA ) treatment neither modified renal IGF 1 nor abolished the renal hypertrophy . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To analyze the consequences of the absence of GH receptor ( GHR ) and GH binding protein ( GHBP ) on female reproductive function , we used a mouse model in which the GHR / GHBP gene has been disrupted by homologous recombination . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
An understanding of the events that occur during GH receptor ( GHR ) signaling has facilitated the development of a GHR antagonist ( pegvisomant ) for use in humans . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Structure and regulation of expression of the mouse GH receptor . ^^^ GH binding protein ( GHBP ) in the mouse consists of a ligand binding domain , which is identical to the extracellular portion of the GH receptor ( GHR ) , and a hydrophilic C terminal domain , in place of the transmembrane and intracellular domains of the GHR . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We examined the impact of cirrhosis on hepatic mRNA and serum protein levels for the GH receptor ( GHR ) / binding protein ( GHBP ) , IGF 1 , IGF binding protein ( IGFBP ) 3 and the acid labile subunit ( ALS ) . ^^^ CONCLUSIONS : The decreased mRNA and serum levels for the GH dependent , hepatocyte produced proteins IGF 1 and ALS confirm the importance of GH receptor loss to the GH resistance of cirrhosis . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Metalloprotease mediated GH receptor proteolysis and GHBP shedding . ^^^ In humans , rabbits , and other species , GHBP derives from proteolytic shedding of the GH receptor ( GHR ) extracellular domain . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This is different from the closely related GH receptor that requires only the phenyl alanine containing motif for endocytosis . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Surprisingly , a disruption or knockout of the gene for the GH receptor ( GHR KO ) , which also produces life extension , had a much smaller effect on gene expression , with no more than 10 genes meeting the selection criterion . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
IL 6 overexpression brings about growth impairment potentially through a GH receptor defect . ^^^ To identify possible steps in GH signaling which might be perturbed in the transgenic mice , we examined the synthesis of GH receptor ( GHR ) mRNA . ^^^ We therefore conclude that overexpression of IL 6 brings about growth impairment in part through a GH receptor defect . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In GH receptor ( GHR ) KO mice litter size is markedly decreased , probably due to an ovarian defect . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Cumulus cells and the oocyte express mRNA for GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The mechanism of this ALC induced depression in IGF 1 is not known , however , could be due to depressed GH and , possibly , to an alteration in the hepatic GH receptor . ^^^ To assess whether ALC has a direct action at the liver , we used a transgenic mouse model that overexpresses GH , allowing assessment of potential direct actions of ALC on the level of either the GH receptor or the IGF 1 synthesizing machinery within the hepatocyte . ^^^ ALC did not alter the circulating levels of bovine GH held constant by the promotor and did not alter mouse GH receptor protein levels as analyzed by Western blotting . ^^^ This direct effect on the hepatocyte is a postreceptor event because the GH receptor protein levels were not altered by ALC exposure . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Neither regulation of hepatic GH receptor nor ALS clearance rates could explain the age dependent effect . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH signaling begins with activation of the GH receptor ( GHR ) associated cytoplasmic tyrosine kinase , Janus kinase 2 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To address this query , we assessed the distribution and whole body elimination kinetics of ( endogenous and exogenous ) GH before and after administration of a novel , potent , and selective recombinant human ( rh ) GH receptor antagonist peptide , pegvisomant . ^^^ Inhibitory efficacy of the GH receptor antagonist peptide was affirmed by way of a 34 % reduction in the serum total IGF 1 concentration , i . e . , from 257 + / 37 ( placebo ) to 170 + / 24 ( drug ) micro g / liter ( P < 0 . 001 ) ; and a reciprocal 77 % elevation of the ( 10 h ) mean GH concentration , i . e . , from 1 . 3 + / 0 . 23 ( placebo ) to 2 . 3 + / 0 . 42 ( drug ) micro g / liter ( P = 0 . 003 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The action of GH is mediated by the GH receptor , a straight chain protein of 620 amino acids with extracellular , transmembrane and cytoplasmic domains . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In the rat , a growth hormone binding protein ( GHBP ) exists that is derived from the growth hormone ( GH ) receptor gene by an alternative mRNA splicing mechanism such that the transmembrane and intracellular domains of the GH receptor are replaced by a hydrophilic carboxyl terminus . ^^^ The transcriptional enhancement did not require GH per se and was not specific to the GH receptor , since similar enhancement of STAT 5 mediated transcription by nuclear localized GHBP was obtained with specific ligand stimulation of both prolactin and erythropoietin receptors . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Glucose is believed to be the primary trigger for the normalisation of the effects of fasting on these plasma variables by restoring hepatic GH receptor capacity , as well as decreasing deiodinase type 3 activity . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Changes at GH receptor level , together with an increased pituitary GH secretion and / or decreased GH turnover may be expected . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In the present study , we overexpressed lymphocyte GH in EL 4 lymphoma cells , which lack the GH receptor ( GHR ) , to determine the role of endogenous GH in nitric oxide ( NO ) production and response to genotoxic stress . ^^^ Taken together , the data support the notion that lymphocyte GH , independently of the GH receptor , may play a key role in the survival of lymphocytes exposed to stressful stimuli via the production of NO . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This review provides an overview of GH and the GH / insulin like growth factor ( IGF 1 ) axis and highlights a GH receptor antagonist ( i . e . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have reported that TNF alpha suppresses hepatic GH receptor ( GHR ) gene expression , whereas the cytokine inducible SH 2 containing protein 1 ( Cis ) / suppressors of cytokine signaling ( Socs ) genes are upregulated by TNF alpha and IL 6 and inhibit GH activation of STAT 5 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The growth hormone ( GH ) GH receptor ( GHR ) axis modulates growth and metabolism and contributes to complications of diabetes mellitus . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To investigate the mechanism involved , we studied the effects of estrogen on GH signaling through Janus kinase ( JAK ) 2 and the signal transducers and activators of transcription ( STATs ) in HEK 293 cells stably expressing the GH receptor ( 293GHR ) , HuH 7 ( hepatoma ) and T 47D ( breast cancer ) cells . 293GHR cells were transiently transfected with an estrogen receptor alpha expression plasmid and luciferase reporters with binding elements for STAT 3 and STAT 5 or the beta casein promoter . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Signaling in the human growth hormone ( hGH ) human GH receptor system is initiated by a controlled sequential two step hormone induced dimerization of two hGH receptors via their extracellular domains ( ECDs ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Insulin restores GH responsiveness during lactation induced negative energy balance in dairy cattle : effects on expression of IGF 1 and GH receptor 1A . ^^^ Our objectives were to examine the effects of insulin administration during the immediate postpartum period on plasma IGF 1 and GH concentrations and to examine the hepatic expression of total GH receptors ( all GH receptor transcripts ) , GH receptor 1A ( GHR 1A ) and IGF 1 . ^^^ In addition , we examined adipose tissue for total GH receptor and IGF 1 mRNA levels to establish the effects of chronic hyperinsulinemia on an insulin responsive peripheral tissue . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Plasma and pituitary GH concentrations and liver GH receptor ( GHR ) , IGF 1 and IGF binding protein 3 ( IGFBP 3 ) mRNA expression were determined in brushtail possum ( Trichosurus vulpecula ) pouch young aged 12 150 days post partum and in adults . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH stimulates the phosphorylation of tyrosine residues in the GH receptor ( GHR ) , Janus kinase 2 ( JAK 2 ) , and other signaling proteins in a transient manner that subsides within 1 h . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The expression of GH receptor , IGF 1 receptor , and IGF 1 mRNAs was confirmed . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Association between the GH receptor / exon 3 genotype and the level of exon 3 positive GH binding protein in human serum . ^^^ OBJECTIVE : The human GH binding protein ( GHBP ) is derived from the GH receptor ( GHR ) through proteolytic cleavage of its extracellular domain . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) promotes signaling by causing activation of the non receptor tyrosine kinase , JAK 2 , which associates with the GH receptor . ^^^ We now further explore GH induced EGFR phosphorylation in 3T3 F442A , a preadipocytic fibroblast cell line that expresses endogenous GH receptor , EGFR , and ErbB 2 . ^^^ Growth hormone ( GH ) promotes signaling by causing activation of the non receptor tyrosine kinase , JAK 2 , which associates with the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Molecular modeling suggested that both K41R and T175A might compromise GH receptor binding . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH receptor is expressed as an active , full sequence molecule and a truncated , inactive one that lacks the intracellular signaling domain . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Dwarf mice have also been created by disrupting or ' knocking out ' the GH receptor gene . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Pegvisomant is a new GH receptor antagonist that blocks GH activity by inhibiting functional dimerisation of GH receptors . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Dexa increased insulin like growth factor ( IGF ) 1 , but decreased growth hormone ( GH ) and IGF binding protein ( IGFBP ) 1 and 2 plasma concentrations and increased GH receptor ( GHR ) mRNA levels in liver . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Greatly enhanced efficacy is expected from the GH receptor antagonist pegvisomant , which is nearing market availability and will enable the normalization of serum IGF 1 in virtually all patients treated . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Mutations in the GH receptor gene ( GHR ) cause congenital GH insensitivity , a genetic disorder characterized by severe growth retardation associated with high serum concentration of GH and low serum levels of IGF 1 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Local changes of IGF 1 mRNA , GH receptor mRNA , and fiber size in rat plantaris muscle following compensatory overload . ^^^ GH receptor mRNA expressions were decreased following compensatory overload , and almost disappeared 14 d after the compensatory overload in hypophysectomized rats . ^^^ Thus muscle fiber hypertrophy following compensatory overload was different among the parts in a muscle and IGF 1 mRNA was expressed in concert with the region specific hypertrophy , but not GH receptor mRNA . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
On the horizon is the GH receptor antagonist pegvisomant , which is expected to enable the reduction of serum IGF 1 to the normal range in the vast majority of postoperative acromegaly patients , representing a revolutionary development in the medical treatment of this disease . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The ability of GH to stimulate lipogenesis and tyrosine phosphorylation of the GH receptor ( GHR ) , Janus kinase 2 ( Jak 2 ) , insulin receptor substrate 1 ( IRS 1 ) and 2 ( IRS 2 ) was greatly reduced in refractory as compared to responsive primary rat adipocytes . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Triiodothyronine , at a high concentration ( 10 ( 7 ) M ) , stimulated GH receptor ( GHR ) mRNA levels by 165 . 20 + / 16 . 54 % after 24 h ( p < 0 . 05 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Transcript levels of LDL r , HMG CoA reductase and GH receptor ( GH r ) were measured at days 2 and 4 and intracellular lipid content was evaluated by oil red O staining . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This immunoreactivity is also associated with the presence of GH receptor ( GHR ) immunoreactivity and GHR mRNA in ocular tissues of chick embryos . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Effect of growth hormone ( GH ) on in vitro nuclear and cytoplasmic oocyte maturation , cumulus expansion , hyaluronan synthases , and connexins 32 and 43 expression , and GH receptor messenger RNA expression in equine and porcine species . ^^^ The expression of GH receptor mRNA was studied in oocytes and cumulus cells of the two species using reverse transcription polymerase chain reaction with specific primers . ^^^ The GH receptor mRNA was detected in equine and porcine oocytes and cumulus cells . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The uterine GH receptor mRNA level was highest in the E 2 treated animals . ^^^ In ICI treated rats no GH receptor mRNA could be detected . ^^^ CONCLUSIONS : The uterine wet weight , the LE height and the GH receptor mRNA levels showed similar patterns , indicating that GH is involved in the regulation of uterine weight . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In acromegalic patients we found higher levels of thymulin secretion , whereas the opposite was seen in dwarf mice and GH receptor knockout animals . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Here , we examine the importance of ligand activation of the GH receptor ( GHR ) associated Janus kinase ( JAK ) 2 and receptor dimerization for hormone internalization and nuclear translocation by use of cells stably transfected with cDNA for the GHR . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Novel new therapies for acromegaly include the somatostatin analog , lanreotide , Gamma Knife radiosurgery , and pegvisomant , the first in its class of new GH receptor antagonists . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This study tested the hypothesis that LDPP increases the expression of GH receptor ( GHR ) 1A messenger RNA ( mRNA ) in the liver . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Reduced proteolysis of rabbit growth hormone ( GH ) receptor substituted with mouse GH receptor cleavage site . ^^^ GH binding protein ( GHBP ) is a circulating form of the GH receptor ( GHR ) extracellular domain , which derives by alternative splicing of the GHR gene ( in mice and rats ) and by metalloprotease mediated GHR proteolysis with shedding of the extracellular domain as GHBP ( in rabbits , humans , and other species ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptor mRNA , probably with GH binding protein mRNA , was detected in somatotrophs , and some mammotrophs and gonadotrophs by in situ hybridization using GH receptor cDNA as a probe . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Pegvisomant , a GH receptor antagonist capable of normalizing serum IGF 1 in over 97 % of patients , represents a novel treatment strategy in acromegaly and its effect on leptin has not previously been reported . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
HEK 293T cells transiently transfected with ovine ( o ) GH receptor ( GHR ) and prolactin receptor ( PRLR ) constructs respectively tagged downstream with cyan or yellow fluorescent proteins were used to study ovine placental lactogen ( oPL ) stimulated heterodimerization by fluorescence resonance energy transfer ( FRET ) microscopy . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The aim of this study was to determine GH receptor ( GHR ) mRNA expression in muscle atrophy . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have used substrate trapping mutants of a large set of PTPs to identify members of the PTP family that have substrate specificity for the phosphorylated human GH receptor ( GHR ) intracellular domain . ^^^ We then used GH induced , phosphorylated GH receptor , purified from overexpressing mammalian cells , in a Far Western based approach to test whether these seven PTPs were also capable of recognizing ligand induced , physiologically phosphorylated GHR . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Monoclonal antibody ( MAb ) 263 is a widely used monoclonal antibody that recognizes the extracellular domain ( ECD ) of the GH receptor . ^^^ A library of 5200 clones of rabbit GH receptor ECD mutants were screened both with MAb 263 and with an anticarboxy tag antibody to verify complete ECD expression . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We hypothesized that the physiological IGF I / GH negative feedback loop may be reset in somatotroph adenomas , specifically in terms of the level of expression of these receptors or mutations of the GH receptor ( GH R ) in such tumours . ^^^ Real time RT PCR assay was used for the quantification of the type 1 IGF receptor ( IGF R ) and GH receptor ( GH R ) mRNA , and sequence analysis was performed on the coding region of the GH R gene . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH signaling depends on functional interaction of the GH receptor ( GHR ) and the cytoplasmic tyrosine kinase , Janus kinase 2 ( JAK 2 ) , which possesses a C terminal kinase domain , a catalytically inactive pseudokinase domain just N terminal to the kinase domain , and an N terminal half shown by us and others to harbor elements for GHR association . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We investigated the bioactivity of GH and compared with their immunoactivity in GH bioassay system using lactogenic hormone responsive element ( LHRE ) reporter gene in Chinese hamster ovary cells transiently co transfected with human GH receptor cDNA and LHRE / TK luciferase reporter gene ( LHRE / Luc ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To study these roles , we previously generated two different dwarf mouse lines , one expressing a GH antagonist ( GHA ) and the other having a disrupted GH receptor and binding protein gene ( GHR / ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Leptin exhibited a dose dependent stimulatory effect on GH secretion by PBMCs and also up regulated the GH receptor gene expression . ^^^ We did not observe any additive effects of leptin on GH secretion upon activation of cells with the plant mitogen phytohemagglutinin , unlike leptin , phytohemagglutinin exerted no effect on GH receptor mRNA expression . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Studies highlighting the events involved in GH receptor signaling have allowed the development of a pegylated GH receptor antagonist ( pegvisomant ) for use in humans , which has been designed to outcompete GH for the GH receptor , but which contains a position 120 amino acid substitution that prevents recruitment of a second GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The liver GH receptor mRNA was also decreased by LPS administration , but only in the animals injected with high LPS doses . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The transcripts of IGF 1 , IGF 2 , IGF receptor ( IGF R ) , two IGF binding proteins ( IGFBP 2 and IGFBP 5 ) , GH receptor ( GH R ) and insulin receptor ( 1 R ) were measured by RT PCR at 4 , 8 , 12 and 16 weeks of age in the ovaries of ad libitum fed and feed restricted hens . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) stimulated insulin like growth factor 1 gene expression is mediated by a tyrosine phosphorylation pathway depending on C terminal region of human GH receptor in human GH receptor expressing Ba / F3 cells . ^^^ In this study , the GH dependent IGF 1 gene expression and its intracellular signaling mechanism have been examined in mouse pro B , Ba / F3 cells stably expressing human GH receptor ( Ba / F3 hGHR ) . ^^^ Growth hormone ( GH ) stimulated insulin like growth factor 1 gene expression is mediated by a tyrosine phosphorylation pathway depending on C terminal region of human GH receptor in human GH receptor expressing Ba / F3 cells . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Current guidelines for the treatment of acromegaly have not considered recent advances in medical therapy , in particular , the place of pegvisomant , a GH receptor antagonist . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) is neuroprotective , presumably through its actions on GH receptor mediated pathways . ^^^ GH treatment reduced neuronal death compared with untreated cultures ( p < 0 . 001 ) , which was blocked by a GH receptor antagonist , B 2036 . ^^^ Expression of both p 53 and GH receptor were increased in brain tissue from HIV infected persons compared with controls ( p < 0 . 05 ) . ^^^ Growth hormone ( GH ) is neuroprotective , presumably through its actions on GH receptor mediated pathways . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Conversely , GH receptor antagonism resulted in up regulation of myostatin in myoblasts . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) hypersecretion and GH receptor resistance in streptozotocin diabetic mice in response to a GH secretagogue . ^^^ Livers were removed and frozen for determination of the mRNA expressions of the GH receptor , GH binding protein , and IGF 1 , and hepatic IGF 1 peptide . ^^^ Growth hormone ( GH ) hypersecretion and GH receptor resistance in streptozotocin diabetic mice in response to a GH secretagogue . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Since osteoclast function may be affected by these factors , the aim of this study was to determine the distribution of GH receptor ( GHr ) , IGF 1 , EGF and IL 1alpha , in osteoclasts located occlusal to the erupting first molar , in the ' eruption pathway ' , in normal and ia / ia rats . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The advent of the GH receptor antagonist pegvisomant provides the potential for IGF 1 to be normalised in virtually every patient , but this novel form of therapy , which does not act on the pituitary , also raises many questions . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptor mRNA and protein have been found in ovarian cells , and this suggests that the direct action of GH provides an important modulatory effect on gonadotropin dependent and independent functions . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Similarly , it has been demonstrated that in transgenic mice expressing various GH genes , in insulin like growth factor 1 ( IGF 1 ) gene knockout mice , in GH receptor gene disrupted ( GHR KO ) mice , and in Ames dwarf mice the onset of puberty and / or fertility is altered . ^^^ We have shown that the hypothalamic pituitary functions are affected in transgenic mice expressing the GH genes , Ames dwarf mice and in GH receptor gene knockout mice . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Pegvisomant is a GH receptor antagonist that normalizes serum IGF 1 in 97 % of patients with active acromegaly . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These achievements include the cloning of a variety of GH and GH receptor ( GHR ) genes and cDNAs ; solving of the three dimensional structure of GH and the GH / GHR complex , and the discovery of GH antagonists . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The first homozygous mutation ( S226I ) in the highly conserved WSXWS like motif of the GH receptor causing Laron syndrome : supression of GH secretion by GnRH analogue therapy not restored by dihydrotestosterone administration . ^^^ OBJECTIVE : The study describes for the first time , a homozygous mutation in the WSXWS like motif of the human GH receptor ( GHR ) in a patient with Laron syndrome and describe laboratory data during treatment with GnRHa to suppress puberty and dihydrotestosterone ( DHT ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Direct genomic DNA sequencing revealed neither a mutation nor deletion in this patient ' s GH receptor ( GHR ) gene , though one polymorphism was detected , indicating that his GHR gene was normal . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Serum IGF 1 normalization ( 699+ / 76 to 242+ / 28 microg / L , P < 0 . 0001 ) was associated with a fall in total IGFBP 3 ( 4345+ / 194 to 3283+ / 160 microg / L , P < 0 . 001 ) due to a reduction in 150 kDa ternary complex associated IGFBP 3 ( 3908+ / 160 to 3008+ / 140 microg / L , P < 0 . 0001 ) . 45 kDa IGFBP 3 and in vivo IGFBP 3 proteolysis were unaffected by GH receptor blockade ( 326+ / 13 to 330+ / 18 microg / L , P=0 . 86 ; 30+ / 3 . 5 to 30+ / 3 . 9 % , P=0 . 75 , respectively ) . ^^^ CONCLUSIONS : GH receptor blockade in patients with acromegaly lowers IGF 1 and 150 kDa IGFBP 3 ternary complex formation . 50 kDa ternary complex formation ( not in vivo IGFBP 3 proteolysis ) is GH dependent and measurement of 150 kDa ternary complex associated IGFBP 3 may provide useful information regarding treatment efficacy in patients with acromegaly . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
No GH receptor polymorphisms were identified in the patient ' s genomic DNA . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) binding and expression of GH receptor 1A mRNA in hepatic tissue of periparturient dairy cows . ^^^ Liver GH receptor transcript ( GHR 1A ) is transiently decreased near parturition and may reduce GH dependent signaling leading to low blood insulin like growth factor 1 ( IGF 1 ) concentrations in periparturient dairy cattle . ^^^ Growth hormone ( GH ) binding and expression of GH receptor 1A mRNA in hepatic tissue of periparturient dairy cows . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Aryl hydrocarbon receptor mediated suppression of GH receptor and Janus kinase 2 expression in mice . ^^^ The expression of MUP 2 is known to be stimulated by growth hormone ( GH ) , through the GH receptor ( GHR ) , Janus kinase 2 ( JAK 2 ) and signal transducer and activator of transcription 5 ( STAT 5 ) signal transduction pathway . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
SOCS 2 binds to the GH receptor and inhibits GH signaling , including attenuation of STAT 5 activation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Preliminary experiments confirmed the expression of the GH receptor ( GHR ) gene in primary cultures of neonatal rat cardiomyocytes ( PC ) , the specific binding of GH by HL 1 cardiomyocytes , and the GH induced activation of GHR and its classical downstream effectors in the latter . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We previously reported a patient affected with an 10 linked SCID due to L183S hemizygous missense gamma chain mutation , whose severe short stature was due to a peripheral growth hormone ( GH ) hyporesponsiveness associated to abnormal GH receptor ( GH R ) signal transduction . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The negative regulation of STATs seems to be exerted at the GH receptor ( GHR ) / Janus Kinase ( JAK ) complex and involves two main mechanisms : ( 1 ) the GH induced ubiquitination / internalization of GHR and ( 2 ) the action of SOCS proteins . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The hypothalamic somatostatin ( SS ) and pituitary growth hormone ( GH ) mRNA expression as well as the plasma GH levels were higher in layer chickens while the opposite was true for hepatic GH receptor ( GHR ) mRNA . ^^^ The strain differences were diminished but did not completely disappear on the same diet basis for hepatic GH receptor mRNA . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Our objective was to determine whether the intestinal mucosa is resistant to the mitogenic effects of exogenous growth hormone ( GH ) but sensitive to exogenous insulin like growth factor 1 ( IGF 1 ) during total parenteral nutrition ( TPN ) because of decreased GH receptor ( GHR ) binding or postreceptor responsiveness to GH . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Clinical and laboratory investigations starting in 1958 of a group of dwarfed children resembling isolated GH deficiency but who had very high serum levels of GH led to the description of the syndrome of primary GH resistance or insensitivity ( Laron syndrome ) and subsequently to the discovery of its molecular defects residing in the GH receptor and leading to an inability of IGF 1 generation . ^^^ This syndrome proved to be a unique model that enables the study of the consequences of GH receptor defects , the physiopathology of GH IGF 1 disruption , and comparison of the GH independent IGF 1 effects . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) insensitivity syndrome due to a GH receptor truncated after Box 1 , resulting in isolated failure of STAT 5 signal transduction . ^^^ Congenital GH insensitivity syndrome ( GHIS ) is usually the result of a mutation in the extracellular domain of the GH receptor ( GHR ) . ^^^ Growth hormone ( GH ) insensitivity syndrome due to a GH receptor truncated after Box 1 , resulting in isolated failure of STAT 5 signal transduction . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In these animals , GH receptor and membrane associated JAK 2 kinase are increased 4 . 5 and 6 fold , respectively . ^^^ This could account for the inhibition of STAT 5 activation , because CIS competes with STAT 5 for GH receptor docking sites . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In the female GH receptor gene knockout ( GHR KO ) mice , there was impairment in follicular development , ovulation rate , sexual maturation , production of and responsiveness to pheromonal signals , and the corpus luteum function . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
There was a decline in histone 4 expression , IGF 1 protein , IGF binding protein 3 , and bone morphogenetic protein 7 staining and a mild increase in IGF 1 receptor , GH receptor , and gelatinase B expression in the Nx Ca ( 2+ ) + GH group when compared with the Intact Control group . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptor ( GHR ) mRNA is expressed in bovine in vitro produced embryos up to the blastocyst stage and GH improves the quality of bovine embryos by increasing blastocyst cell numbers and reducing the incidence of apoptosis as evaluated by DNA strand break labelling . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
All receptors , with the exception of GH receptor subsequently decrease by age 6 months . ^^^ Conversely , 6 month old offspring showed no difference in the abundance of either GH receptor or PRL receptor , while IGF 2 mRNA was increased . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH is a critical growthpromoting and metabolic regulatory hormone that binds the GH receptor , thereby engaging various signaling pathways , including ERKs . ^^^ Prior studies suggest cross talk between the GH receptor and EGFR signaling systems . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We report the isolation and characterization of the GH receptor ( GH R ) and its gene expression profile during oogenesis in the tilapia , Oreochromis mossambicus . cDNA encoding GH R was cloned and sequenced from the tilapia liver . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Although traditional methods of treatment aim at suppressing GH hypersecretion from the pituitary tumor , recent studies on the use of the GH receptor antagonist have shown that targeting the action of GH on peripheral tissues may be more effective . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Here we examine several cortical and subcortical neuronal populations in GH hyper responsive SOCS 2 null ( / ) mice and GH non responsive GH receptor null ( GHR / ) mice . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In NFPA tissue from 14 patients we evaluated GH receptor ( GHR ) expression and signal transduction , and the effect of GH and IGF 1 exposure on cell proliferation and hormone secretion in vitro . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Molecular analysis of the GH receptor gene in the patient and her parents was performed . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In liver , these responses were associated with increased abundance of the GH receptor protein ( GHR ; P < 0 . 05 ) , whereas the abundance of intracellular mediators of GH actions ( JAK 2 , STAT 5 , or STAT 3 ) remained unaffected . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Primary GH insensitivity ' ( Laron syndrome ) caused by a novel 4 kb deletion encompassing exon 5 of the GH receptor gene : effect of intermittent long term treatment with recombinant human IGF 1 . ^^^ Fifty one different mutations in the GH receptor ( GHR ) gene have been discovered , whereas only three deletions causing the disorder have been reported so far . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Pegvisomant , in contrast to classical somatostatin analogs which lower hGH synthesis , exerts its anti hGH action by preventing GH receptor activation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone insensitivity resulting from post GH receptor defects . ^^^ Given that the GH receptor is a member of the hematopoietin receptor family , it seems reasonable to predict that additional cases of defects in GH signaling will be identified . ^^^ Growth hormone insensitivity resulting from post GH receptor defects . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In the present study we investigated the potential influence of IGFBP 1 on GH secretion in the absence or presence of a GH receptor antagonist ( GHRA ) that specifically blocks peripheral GH action . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH receptor antagonists compete with naturally occurring GH for binding with the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Gene expression of the GH receptor in subcutaneous and intraabdominal fat in healthy females : relationship to GH binding protein . ^^^ OBJECTIVE : Circulating GH binding protein ( GHBP ) is produced by proteolytical cleavage of the extracellular part of the GH receptor ( GHR ) and is positively correlated to the amount of body fat . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Several groups of patients have been treated effectively , including individuals with growth hormone insensitivity syndrome ( GHIS ) secondary to GH receptor deficiency , to IGF 1 gene deletion , or to defects in GH signal transduction pathways , patients with type 1 and type 2 diabetes mellitus , or individuals with severe insulin resistance syndromes . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Dwarf GH receptor knockout mice ( GHR / ) and bovine GH antagonist expressing mice ( GHA ) had an increased percent body fat with most of the excess fat mass accumulating in the subcutaneous region . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In summary , obese children present normal growth in spite of reduced GH secretion , probably because the combination of increased total GHBP and normal GH GHBP complex serum levels ( suggesting increased GH receptor [ GHR ] number and a normal serum GH reservoir , respectively ) allow for the achievement of normal levels of IGF 1 , IGFBP 3 , IGFBP 3 proteolytic activity , IGFBP 3 plasma fragments and total ALS . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Stomach ghrelin mRNA expression and serum concentrations of ghrelin were measured in three groups of transgenic mice and the respective control animals : group 1 , GH receptor gene disrupted mice ( GHR / KO ) ; group 2 , mice expressing bovine GH ( bGH ) ; and group 3 , mice expressing GH antagonist ( GHA ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The somatotropic axis , consisting of growth hormone ( GH ) , GH receptor ( GHR ) , insulin like growth factor ( IGF ) 1 , IGF binding proteins ( IGFBP ) , and IGF receptors , controls growth and mammary development in heifers . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Targeted mutations that affect components of this pathway , including the GH receptor , p66Shc , and the IGF 1 receptor ( IGF 1R ) , also extend life span ; mutations that affect IGF 1R or downstream components of the pathway decouple longevity effects from dwarfism . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The increased biopotency of GH that we observe can be explained by a model for GH receptor activation where subunit alignment is critical for effective signaling . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Recently , the first data on the use of genetically engineered human GH receptor ( GHR ) antagonists that block GH actions have become available . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The two highest levels of circulating GH increased all forms of the GH receptor , IGF 1 , and hepatic lipoprotein lipase mRNA . ^^^ The growth differential observed for the 0 vs . the 15 mM zinc stimulated transgenics may reflect the preferential increase in the full length GH receptor mRNA and the induction of the smaller IGF 1 transcripts with the higher circulating GH while the lipid accrual paralleled the disproportionate induction of the truncated GH receptor mRNA form . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Therefore , we investigated the effect of chronic GH excess or disruption of GH receptor ( GHR ) signalling , and the acute effect of GH administration on expression of muscle IGF 1 isoforms using transgenic mice that express bovine GH ( bGH ) , GHR gene disrupted ( GHR / ) mice and GH deficient lit / lit mice before and after exogenous GH administration . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Neither female GH antagonist dwarf mice nor GH receptor knockout mice had any granular cells expressing EGF in any gland . ^^^ Furthermore , absence of granular duct cells from all glands in female GH antagonist and GH receptor knockout transgenic mice suggests that GH is necessary for the differentiation of the granular cell phenotype in female salivary glands . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Transcripts of TSH receptor , GH receptor and ACTH receptor were detected in this cell line . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In its classic form , the phenotype is identical to that of GH deficiency , and was originally described in association with defects of the GH receptor . ^^^ Primary IGFD may be due to : ( 1 ) defects of the GH receptor , ( 2 ) defects of post GH receptor signaling or ( 3 ) primary defects of IGF 1 synthesis . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
When the rats were killed , GH receptor mRNA and protein levels were similar in the two groups . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH receptor ( GHR ) mediates metabolic and somatogenic actions of GH . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Serum levels of T 4 , pituitary GH , hepatic GH receptor ( GHR ) and type 1 IGF receptor ( IGF 1R ) mRNA expression were all suppressed markedly in the daidzein treated group at hatching , but this suppression proved to be temporary , as at 4 weeks of age , expression levels of all investigated genes were restored . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH activated Janus associated kinase 2 ( JAK 2 ) signal transducers and activators of transcription 5 ( STAT 5 ) signaling was impaired in CRF rats , despite normal GH receptor ( GHR ) , JAK 2 , and STAT 5 protein levels . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
BACKGROUND : Laron Syndrome , first described in Israel , is a form of dwarfism similar to isolated growth hormone deficiency caused by molecular defects in the GH receptor gene . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Western blot analyses were used to monitor the presence of several parameters known to be affected by GH in these cells ( i . e . , downregulation of GH receptor , induction of STATs , and extracellular signal regulated kinase [ ERK ] mitogen activated protein kinase [ MAPK ] pathways ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In order to evaluate the line specific developmental patterns of negative feedback regulation of GH secretion , Erhualian ( EHL ) and Large White ( LW ) pigs with significant difference in growth rate were employed in present study to investigate the developmental changes of GH receptor ( GHR ) mRNA and type 1 IGF receptor ( IGF 1R ) mRNA in hypothalamus and pituitary from birth till 180 days of age by relative quantitative RT PCR . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The mechanism by which the GH antagonists appear to operate is to inhibit proper or functional GH receptor dimerization . ^^^ A GH receptor antagonist , pegvisomant , has been developed for these clinical situations . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Genetic alterations of the GH receptor lead to the so called Laron ' s syndrome . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Lessons from 6 years of GH receptor antagonist therapy for acromegaly . ^^^ Pegvisomant is a GH receptor antagonist and a new agent for the medical management of acromegaly . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The use of a GH receptor antagonist in patients with acromegaly resistant to somatostatin analogs . ^^^ Pegvisomant , a GH receptor antagonist , is a new pharmaceutical approach to acromegaly . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To address the interaction of these two interventions , we subjected normal ( N ) and long lived GH receptor knockout ( GHRKO ) mice to CR for 20 months starting at weaning . ^^^ These results also add to the evidence that targeted disruption of the GH receptor / GH binding protein gene and CR act via overlapping , but distinct , mechanisms . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The presence of GH receptor mRNA in the testis and vas deferens also suggests they are target sites for GH action . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In this study , we measured mRNA levels of 11betaHSD1 and GS in skeletal muscle of GH receptor gene disrupted ( GHR / ) mice and of their age matched wild type mice controls to elucidate the physiological significance of 11betaHSD1 and GC in the development of GHD associated muscle atrophy in vivo . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH binding protein ( GHBP ) measurement constitutes an indirect estimate of GH receptor number . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In vitro bioassays , based on the proliferation of cell lines expressing the prolactin receptor or GH receptor , are sensitive but prone to nonspecific interference by factors present in serum . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Pegvisomant is a genetically manipulated growth hormone ( GH ) that disables signal transduction through the GH receptor and thus functions as a GH receptor antagonist . ^^^ This review summarizes studies of the effects of GH receptor blockade and fasting , either alone or in combination , on determinants of GH release . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH insensitivity ( GHI ) is an autosomal recessive disorder caused by defects in the GH receptor ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH receptor antagonist pegvisomant leads to remission in 90 % of patients , using IGF 1 levels for assessment . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This is evidenced by dwarfism in states of congenital IGF 1 deficiency , Igf 1 gene mutation / deletions or knockouts , and in Laron syndrome ( LS ) , due to GH receptor gene mutations / deletions or IGF 1 receptor blocking . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We briefly compare calorie restriction , GHRH R and Pit 1 mutants with knockout phenotypes of GH receptor , IGF 1 receptor and p66Shc , to make some general conclusions . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
IGF 1 levels normalize in the majority of patients with acromegaly treated with the GH receptor antagonist pegvisomant . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Identification and characterization of GH receptor and serum GH binding protein in Chinese sturgeon ( Acipenser sinensis ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This is characterized by normal GH secretion , reduced liver GH receptor ( GHR ) abundance , and reduced circulating insulin like growth factor 1 ( IGF 1 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Studying untreated patients with either isolated GH deficiency due to GH gene deletion , patients with multiple pituitary hormone deficiency due to PROP 1 gene mutation and patients with isolated IGF 1 deficiency due to deletions or mutations of the GH receptor gene ( Laron syndrome ) ; it was found , that these patients despite signs of early aging ( wrinkled skin , obesity , insulin resistance and osteopenia ) have a long life span reaching ages of 80 90 years . ^^^ Animal models of genetic GH deficiencies such as Snell mice ( Pit 1 gene mutations ) the Ames mice ( PROP 1 gene mutation ) and the Laron mice ( GH receptor gene knock out ) have a statistically significant higher longevity compared to normal controls . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The present study investigated the diurnal variation in GH receptor ( GHR ) mRNA in liver and skeletal muscle of 3 month old GH deficient and sufficient mice using quantitative real time RT PCR . lit / lit ( GH deficient ) or lit / + ( GH sufficient ) mice were fed ad libitum and lights were on between 0600 and 2000 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Three features render the GH receptor unique : ( a ) an active ubiquitination system is required for both uptake ( endocytosis ) and degradation in the lysosomes ; ( b ) uptake of the receptor is a continuous process , independent of both GH binding and Jak 2 signal transduction ; ( c ) only the cell surface expression of dimerised GH receptors is controlled by the ubiquitin system . ^^^ This system enables two independent regulatory mechanisms for the endocrinology of the GH / GHR axis : the pulsatile secretion of GH by the pituitary and the GH sensitivity of individual cells of the body by the effects of the ubiquitin system on GH receptor availability . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Treatment with the GH receptor antagonist pegvisomant ameliorates insulin sensitivity , reflected in decreased fasting plasma insulin levels and fasting glucose levels . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Thus , the distribution of GH receptor mRNA to visceral sensory and motor structures is consonant with a role of GH in the regulation of food intake and energy homeostasis . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In addition , the regulatory role of stress induced by protein restriction was investigated with respect to the relative distribution of GH receptor positive lymphoid cells . ^^^ The pattern of expression of the GH receptor differed among the lymphoid tissues and cell subsets . ^^^ Spleen was the most responsive organ to protein deprivation with highest GH receptor expression in B lymphocytes , followed by CD4+ T cells . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Children with short stature due to renal failure are GH sufficient and have some GH receptor signaling capacity , so that rhIGF 1 , or rhIGF 1 plus rhGH , are logical therapeutic options and merit clinical testing . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To examine mechanisms for modulation of GH sensitivity , we measured hepatocyte GH receptor ( GHR ) mRNA levels . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone insensitivity ( GHI ) has been attributable , classically , to mutations in the gene for the GH receptor . ^^^ After binding to the GH receptor , GH initiates signal transduction through a number of pathways , including the JAK STAT pathway . ^^^ Growth hormone insensitivity ( GHI ) has been attributable , classically , to mutations in the gene for the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
SOCS 2 was found to bind 2 phosphorylated tyrosines on the GH receptor , and mutational analysis of these amino acids showed that both were essential for SOCS 2 function . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This hepatic insensitivity to the action of GH may be partly the consequence of reduced GH receptor expression in liver tissue and partly a consequence of disturbed GH receptor signaling . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of the GH receptor may be reduced , although this is not a consistent finding , GH activation of the Janus kinase 2 signal transducer ( JAK 2 ) and activator of transcription ( STAT ) signal transduction pathway is depressed and this leads to reduced IGF 1 expression , and finally there is resistance to IGF 1 , a major mediator of GH action . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This is also observed when IGF 1 is given to patients with GH receptor mutations . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptor antagonist : mechanism of action and clinical utility . ^^^ This review focuses on the development of GH receptor antagonist as a novel agent for treatment of acromegaly , its mechanism of action and potential areas of use . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
By using an in vitro invasion model , we found that EVCT isolated from first trimester chorionic villi and cultured on Matrigel secreted hPGH and expressed human GH receptor ( hGHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH enhanced IGF 1 , IGF binding receptor 3 , and GH receptor but declined with daily and intermittent calcitriol . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptor gene deficiency ( GHR ( / ) ) caused diminished pancreatic islet cell mass and serum insulin level and elevated insulin sensitivity . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Given that the GH receptor is present in the lung from early development , lung GH may have autocrine and / or paracrine roles in lung growth or differentiation or in pulmonary function . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In order to test this hypothesis , female nude mice were xenografted with two different human colorectal cancer cell lines ( COLO 205 and HT 29 ) and randomized to receive placebo or a GH receptor antagonist ( GHRA ) ( B 2036 PEG ) every second day for 16 days . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
If there was in fact an increase in GH sensitivity and GH receptor expression at the liver that was not detected by blood GHBP in this study , it may be possible that factors contributing to the circulating concentration of GHBP other than hepatocytes ( e . g . , leptin and adipocytes ) may serve to mask training induced increases in circulating GHBP of a hepatic origin , thus masking any detectable increase in GH receptor expression . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To investigate the contribution of GH , IGF 1 and apoptosis to growth plate function , the expression of GH receptor ( GHR ) and IGF 1 receptor ( IGF IR ) mRNA were evaluated by in situ hybridization in fractionated costochondral growth plates of growing rats ( at 2 , 4 , and 7 weeks ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Since mRNAs of both GH and GH receptor were present in stem cells and B cell precursors in bone marrow , GH may modulate B lymphoid precursors development in an autocrine or paracrine manner in bone marrows . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Laron syndrome , growth hormone ( GH ) insensitivity syndrome , caused by a mutation of the GH receptor ( GHR ) gene , is extremely rare in the Chinese population . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH receptor is found on the cell surface of osteoblasts and osteoclasts , but not on mature osteocytes . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Individuals heterozygous for the E 180 GH receptor ( GHR ) splice mutation have normal IGF 1 generation , but those homozygous for the E 180 splice mutation have very low basal and stimulated IGF 1 concentrations . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
However , the introduction of the GH receptor antagonist pegvisomant poses new challenges . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
OBJECTIVE : Pegvisomant , a modified growth hormone ( GH ) molecule , is a novel medical therapy for acromegaly that functions as a GH receptor antagonist . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These findings expand our understanding of the evolution of the GH receptor family and suggest that independent mechanisms serve to regulate the tissue specific expression of GHR mRNAs . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We measured overnight fasting concentrations of GH sensitive insulin like growth factor 1 ( IGF 1 ) and IGF binding protein 3 ( IGFBP 3 ) including GH binding protein ( GHBP ) , a marker of GH receptor sensitivity , in antiretroviral treated HIV infected patients with ( LIPO ) and without lipodystrophy ( NONLIPO ) and antiretroviral naive HIV infected patients ( NAIVE ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The availability of medical treatment ( dopamine , DA , agonists , somatostatin analogs , GH receptor antagonists . . . ) has profoundly modified the indications of radiotherapy , drugs being now generally used as a second line treatment , after surgery ( or even as first line treatment ) . ^^^ Pegvisomant , the new GH receptor antagonist , is indicated in case of resistance to somatostatin analogs . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The secretion of IGF 1 in utero is not dependent on GH , whereas in childhood and adult life , IGF 1 secretion seems to be mainly controlled by GH , as revealed from studies on patients with GHRH receptor and GH receptor mutations . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The insulin like effects are mediated by the cytosolic tyrosine kinase Janus kinase 2 ( JAK 2 ) upon GH GH receptor interaction , resulting in tyrosine phosphorylation of downstream targets including the GH receptor itself and insulin receptor substrate 1 ( IRS 1 ) and IRS 2 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The antagonistic properties of a set of GH receptor binding compounds were evaluated . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GHI can be the result of an abnormality in the GH receptor or aberrancies downstream of the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In this study , we examine the effects of IL 1 on GH receptor ( GHR ) expression , GH signaling ( via the JAK / STAT and MAPK pathways ) , and the induction of gene expression [ IGF 1 mRNA and serine protease inhibitor ( Spi ) 2 . 1 ] by GH in CWSV 1 hepatocytes . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To test this hypothesis further , we examined the effects of 10 daily s . c . injections of IGF 1 on NMDA receptor subunits ( NR 1 , NR2A , and NR2B ) , GH receptor ( GHR ) , GH binding protein ( GHBP ) and type 1 IGF receptor ( IGF 1R ) gene transcripts in the hippocampus . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Pegvisomant belongs to a new class of agents known as GH receptor antagonists . ^^^ This novel agent competitively binds to the GH receptor , blocking IGF 1 production . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The PRL receptor ( PRLR ) and GH receptor ( GHR ) have been identified in a number of teleosts but the SL receptor remains to be characterised . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A peak in gh receptor expression is associated with growth activation in Atlantic salmon vertebrae , while upregulation of igf 1 receptor expression is related to increased bone density . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The introduction of a GH receptor antagonist in the 1990s has added to the pharmacologic armamentarium for treatment of acromegaly . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
IGF deficiency ( IGFD ) has emerged as an important clinical diagnosis : secondary IGFD results from insufficient production of GH and is characterized by postnatal growth failure ; primary IGFD can result from abnormalities of the GH receptor or GH signaling cascade , or from mutations or deletions of the IGF 1 gene . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In classical GH insensitivity syndrome ( GHIS ) , known as Laron syndrome , due to GH receptor ( GHR ) deficiency , serum IGF 1 , IGFBP 3 and ALS are severely reduced with inability to produce these peptides during an IGF 1 generation test . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In contrast , GH receptor deficient mice had elevated adiponectin levels , while PRL receptor deficient mice were unaffected . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This was associated with down regulation of GH receptor ( GHR ) expression and impaired GH dependent STAT5b activation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Since the mitogenic potency of GH is dependent upon the presence of the GH receptor ( GH R ) and the subsequent IGF 1 / IGF receptor ( IGF 1 R ) system we investigated the expression of the members of the growth hormone cascade in endocrine inactive and GH producing pituitary adenomas . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The present study examines the effect of GH on telomerase activity and identifies the signal transduction pathway involved in this process in Chinese hamster ovary ( CHO ) 4 cells , which express rat GH receptor cDNA . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
LPS decreased GH receptor and IGF 1 gene expression in the liver of saline treated rats but not in the liver of dexamethasone pretreated rats . ^^^ In the kidney , GH receptor mRNA levels were not modified by dexamethasone or LPS treatment . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
OBJECTIVE : To report our experience on long term treatment with recombinant human IGF 1 ( rhIGF 1 ) of a female patient with Laron syndrome ( mutation G223G in the GH receptor gene ) , who received short term treatment ( 1 yr ) with LHRH analogue at the start of puberty and subsequently with oxandrolone . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The results suggest that one of the consequences of the overexpression of GH , in cells lacking the GH receptor , is an increase in the expression of IGF 1 and the IGF 1R which mediate the protection of EL 4 lymphoma cells from apoptosis . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Understanding the mechanisms by which growth hormone ( GH ) interacts with its receptor has led to the design of compounds that function as GH receptor antagonists . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Half the individuals with Noonan syndrome carry a heterozygous mutation of the nonreceptor type protein tyrosine phosphatase , Src homology region 2 domain phosphatase 2 ( SHP 2 ) , encoded by PTPN 11 , which has a role in GH receptor signaling . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Janus kinase 2 ( JAK 2 ) has been identified as the first intracellular step in GH receptor ( GHR ) signaling in many species , however , there is limited knowledge regarding the GH signaling pathway in the chicken . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Using a new rabbit polyclonal antibody ( 7122A ) directed against the recombinant extracellular domain of GH receptor ( GHR ECD ) for western blot assays , we found two bands with apparent molecular weights of 70 , 000 and 50 60 , 000 Da in ovine mammary gland solubilized proteins . ^^^ The 70 , 000 protein was consistent with a membrane GH receptor form deprived of post translational modifications such as phosphorylation , glycosylation or ubiquitin binding . ^^^ The 50 60 , 000 Da was consistent with soluble GH binding protein , generated by the cleavage of membrane GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Recently GH receptor blockers ( pegvisomant ) were introduced in the treatment of GH producing pituitary adenomas . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In recent years , some of the components that take part in the down regulatory mechanism targeting the activated GH receptor ( GHR ) have been defined , and the physiological significance of some of these key components has begun to be characterized . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
CONTEXT : Pegvisomant is a GH receptor antagonist that blocks the peripheral actions of GH in acromegaly . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptor mRNA and immunoreactivity were also widespread and abundant within the embryonic lung . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Skeletal hypothyroidism in TRalpha 1 ( PV ) mutants was accompanied by impaired GH receptor and IGF 1 receptor expression and signaling in the growth plate , whereas GH receptor and IGF 1 receptor expression and signaling were increased in TRbeta ( PV ) mice . ^^^ These data indicate that GH receptor and IGF 1 receptor are physiological targets for T ( 3 ) action in bone in vivo . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We report our findings on markers of cell proliferation ( Ki 67 labelling index and topoisomerase alpha expression ) in a somatotroph pituitary tumour before and after exposure to pegvisomant , a GH receptor antagonist developed for the treatment of acromegaly . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The abundance of surface GH receptor ( GHR ) is an important determinant of cellular GH sensitivity and is regulated at both transcriptional and posttranscriptional levels . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Three different models of mice with a genetically altered GH axis were used : GH excess ( giant ) , dwarf GH antagonist ( dwarf Ant ) , and dwarf GH receptor knockout ( dwarf KO ) mice . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
However , measurements of IGF 1 and its binding proteins , as well as GH and its binding proteins , can help us to focus our analysis of patients suspected to have genetic abnormalities on the GH receptor , IGF 1 , its receptor , IGFALS , or intracellular signalling proteins such as STAT5b or ERK . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Development of GH receptor antagonist therapy , which inhibits GH activity and normalizes circulating IGF 1 , GH levels remaining elevated , requires re analysis of relationship between GH and IGF 1 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To study this further , we evaluated mRNA levels of pituitary GH , and of IGF 1 , GH receptor ( GHR ) and acid labile subunit ( ALS ) in liver and skeletal muscle of male C3H and B 6 strains . mRNA levels of hepatic IGF 1 paralleled serum IGF 1 levels , whereas pituitary GH mRNA expression was significantly lower in C3H than B 6 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH receptor ( GHR ) gene disrupted mouse ( Ghr ( / ) ) , which has less than 10 % of the plasma IGF 1 found in GHR wild type mice , was crossed with the C 3 ( 1 ) / T antigen ( Tag ) mouse , which develops prostatic intraepithelial neoplasia driven by the large Tag that progress to invasive prostate carcinoma in a manner similar to the process observed in humans . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH receptor ( GHR ) is essential for normal postnatal growth and development , and the molecular basis of GHR action has been studied intensively . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In line with this , we detected GH receptor expression in the papillary carcinoma cells . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
It has been suggested that partial growth hormone ( GH ) insensitivity due to heterozygous mutations of the GH Receptor gene may account for some cases of ISS . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The aim of this study was to elucidate the role of GH in osteogenic differentiation of BMPCs using GH receptor null mice ( GHRKO ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Recently , a GH receptor blocking agent , pegvisomant , was licensed for use in acromegaly and appears to normalise IGF 1 in almost all patients . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The size of the ligand plays less of a role in receptor activation , suggesting that the extracellular portion of the PRLR ( and possibly the GH receptor ) is rather flexible and can accommodate larger ligands . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Recently , a GH receptor antagonist , pegvisomant , was introduced for the treatment of adults with acromegaly . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Physiological concentrations of insulin promote growth probably by modulating liver GH receptor ( GHR ) levels in vivo , but the possible effects of insulin on GH induced post GHR signaling have yet to be studied . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Genes coding for growth hormone ( GH ) and GH receptor ( GHR ) are candidates for quantitative trait markers in farm animals . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
CONTEXT : Low bone mass is a characteristic feature of the adult GH deficiency ( GHD ) syndrome , but recent dual energy 10 ray absorptiometry ( DXA ) studies in patients with GH receptor and GHRH receptor gene mutations suggest that the situation is more complex . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptor and its downstream signal transduction ] . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth disorders caused by mutations of GH 1 or GH receptor gene ] . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
CONTEXT : A protein polymorphism of the GH receptor ( GHR ) based on the genomic deletion of exon 3 ( d 3 GHR ) has recently been linked to the magnitude of growth response to high dose recombinant human GH ( rhGH ) therapy of short children without GH deficiency . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH receptor antagonist controls IGF 1 hypersecretion , and its use in combination with somatostatin analogs in selected patients is tempting but requires further evaluation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
IGFBP 3 , IGF 1 , IGF 1 receptor and GH receptor mRNA levels were quantified using real time RT PCR . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
As well as testing tolerability a test dose of octreotide may help in determining which patients should be offered early external pituitary irradiation or therapy with a GH receptor antagonist if surgery has failed to achieve ' safe ' GH levels . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The advent of the GH receptor antagonist pegvisomant provides the possibility to normalise IGF 1 in virtually every patient . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH rapidly and potently stimulates IGF 1 gene transcription by mechanisms independent of new protein synthesis , and recent studies have linked the transcription factor Stat5b to a regulatory network connecting the activated GH receptor on the cell membrane to the IGF 1 gene in the nucleus . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The correlation between the molecular defects of the GH receptor ( R ) , psychosocial development and brain abnormalities were evaluated in 10 patients with Laron syndrome ( LS ) , in whom all data were available . ^^^ The findings revealed that the intelligence quotient ( IQ ) and abnormalities in the brain of the patients with LS differ with various molecular defects of the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
CONTEXT : GH acts through the GH receptor ( GHR ) , whose polymorphisms might affect the growth response to recombinant human GH ( rhGH ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
CONTEXT : GH insensitivity syndrome ( GHIS ) , Laron syndrome , is characterized by severe short stature , high serum GH levels , and very low serum IGF 1 and IGF binding protein 3 ( IGFBP 3 ) levels associated with a genetic defect of the GH receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
THERAPEUTIC STRATEGIES : Somatostatin analogs , a GH receptor antagonist and dopamine agonists have been shown to alleviate the comorbid features and to normalize GH and IGF 1 levels . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Prop1df / Prop1df mice displayed unaltered GH receptor , JAK 2 and STAT5a / b protein levels . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Uncoupling of the growth hormone ( GH ) axis in early postpartum dairy cows is correlated with a decrease in liver GH receptor ( GHR ) 1A mRNA and a decrease in liver GH receptor protein . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Laron syndrome ( LS ) is an autosomal recessive disease caused by deletions or mutations in the GH receptor gene leading to an inability of insulin like growth factor 1 ( IGF 1 ) generation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
It is well known that lymphoid organs such the thymus , the spleen and peripheral blood produce growth hormone ( GH ) and GH receptor is expressed on different subpopulations of lymphocytes . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Data obtained in knock out ( KO ) mice with GH receptor ( GHR ) / GH binding protein ( GHBP ) gene disruption have shown that these animals are protected against diabetes induced renal changes . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
OBJECTIVE : The new GH receptor antagonist pegvisomant is the most effective medical therapy to normalize IGF 1 levels in patients with acromegaly . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone insensitivity syndrome ( GHIS ) has been reported in a family homozygous for a point mutation in the GH receptor ( GHR ) that activates an intronic pseudoexon . ^^^ Growth hormone insensitivity syndrome ( GHIS ) has been reported in a family homozygous for a point mutation in the GH receptor ( GHR ) that activates an intronic pseudoexon . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Three key elements in this elucidation were the cloning of the GH receptor , the identification of Janus kinase ( JAK ) 2 as the receptor associated tyrosine kinase , and the delineation of signal transduction and activators of transcription ( STAT ) 5a / b as the key transcription factor ( s ) activated by JAK 2 . ^^^ We describe a new model for GH receptor activation based on subunit rotation within a constitutive dimer , together with the phenotype and hepatic transcript profile of mice with targeted knockins to the receptor cytoplasmic domain . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Compared with group M , piglets in group MI exhibited significantly increased expression levels of both insulin and GH receptor in the ileum , and LAP in the jejunum ( p < 0 . 05 ) ; IGF 1 receptor expression levels in both the jejunum and ileum were significantly decreased ( p < 0 . 01 and p < 0 . 05 , respectively ) , while IGF 1 expression was unchanged ( p > 0 . 05 ) . ^^^ CONCLUSION : Collectively , dietary insulin increased mRNA levels of insulin and GH receptor , which could help explain the effect of dietary insulin on receptor mediated postnatal development of the small intestine . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH signals through the GH receptor ( GHR ) , a cytokine receptor superfamily member that couples to the cytoplasmic tyrosine kinase , Janus kinase 2 ( JAK 2 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Efficacy of 12 month treatment with the GH receptor antagonist pegvisomant in patients with acromegaly resistant to long term , high dose somatostatin analog treatment : effect on IGF 1 levels , tumor mass , hypertension and glucose tolerance . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We hypothesized a cortisol induced upregulation of fetal hepatic GH receptor ( GH R ) mRNA levels , secondary increases in IGF 1 mRNA levels , and circulating IGF 1 levels , but a downregulation of the type 1 IGF receptor ( IGF IR ) as an explanation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Reduced recruitment and survival of primordial and growing follicles in GH receptor deficient mice . ^^^ Therefore , serial paraffin sections of ovaries of untreated and IGF 1 treated female GH receptor knock out ( GHR / GHBP KO ) mice were examined to determine the follicular reserve and the percentage of follicular atresia in each ovary . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) pharmacogenetics : influence of GH receptor exon 3 retention or deletion on first year growth response and final height in patients with severe GH deficiency . ^^^ Growth hormone ( GH ) pharmacogenetics : influence of GH receptor exon 3 retention or deletion on first year growth response and final height in patients with severe GH deficiency . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Total GH receptor ( GHR ) , JAK 2 , and STAT 5 signaling proteins and the time course of STAT 5 activation were also measured in liver after recombinant human GH administration by immunoblot and electrophoretic mobility shift analysis . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In humans , circulating GH binding protein ( GHBP ) , the extracellular domain of the GH receptor that is shed into the circulation and is believed to reflect tissue GH receptor levels , is reduced in uremia and suggests that cellular GH receptor levels are correspondingly reduced . ^^^ We set out to establish whether serum GHBP levels reflect cellular GH receptor levels and whether changes in serum GHBP levels are related to nutritional or inflammatory status . ^^^ METHODS : GH receptor protein expression in peripheral blood mononuclear cells ( PBMC ) from 21 ESRD and 14 normal subjects were analyzed by fluorochrome flow cytometry . ^^^ RESULTS : The GH receptor density and percent total PBMCs expressing the GH receptor were similar in the 2 groups , and there was no difference in percent GH receptor positive T or B cells or monocytes . ^^^ Because GH receptor expression on PBMC of ESRD and control subjects was similar , our findings argue against a reduction in GH receptor as a cause of GH resistance and the use of serum GHBP levels as a reliable marker of specific tissue GH receptor levels . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Thus STAT5b and HNF4alpha exhibit bi directional cross talk that may augment HNF4alpha dependent gene transcription while inhibiting STAT5b transcriptional activity via the inhibitory effects of HNF4alpha on JAK 2 phosphorylation , which leads to inhibition of STAT5b signalling initiated by the GH receptor at the cell surface . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
At the tissue level , the action of GH is mediated by the GH receptor ( GHR ) and the receptor activated intracellular signaling pathway involving Janus kinase 2 ( JAK 2 ) and signal transducer and activator of transcription 5 ( STAT 5 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We report on four patients ( 3 F ) who were diagnosed as having either a 6 . 7 kb GH 1 gene deletion , a GH 1 signalling peptide mutation , or a GH receptor mutation , with particular regard to treatment modalities ( GH , rhIGF 1 ) and final height . ^^^ GH resistance , either caused by GH Ab or GH receptor mutations , is still difficult to treat and results in a heterogeneous outcome . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
It is suggested that higher tissue GH receptor responsiveness in non obese androgenized women may contribute to their higher BMD . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A GH receptor antisense oligonucleotide inhibits hepatic GH receptor expression , IGF 1 production and body weight gain in normal mice . ^^^ We have designed an optimised 2 ' O ( 2 methoxyethyl ) modified phosphorothioate oligodeoxynucleotide , ATL 227446 , and demonstrated its ability to suppress GH receptor mRNA in vitro . ^^^ Subcutaneous injections of ATL 227446 reduced GH receptor mRNA levels , GH binding activity and serum IGF 1 levels in mice after seven days of dosing . ^^^ The findings indicate that administration of an antisense oligonucleotide to the GH receptor may be applicable to human diseases in which suppression of GH action provides therapeutic benefit . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Currently available medical treatment of acromegaly includes dopamine agonists , slow release formulation of somatostatin analogues and pegvisomant , a GH receptor antagonist . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
H ) In order to monitor treatment with GH receptor antagonists , a reliable IGF 1 assay is of critical importance , since GH measurements can not be used to evaluate treatment efficacy . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In the present study , mice with targeted disruption of the growth hormone ( GH ) receptor [ GH receptor / GH binding protein knockout ( GHRKO ) mice ] and their normal siblings were fed ad libitum ( AL ) or subjected to 30 % CR starting at 2 months of age . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This correlated with recovery of GH receptor levels , but was insufficient for GH induced phosphorylation of MEK1 / 2 and ERK1 / 2 . ^^^ Insulin restored the ability of a second GH exposure to induce phosphorylation of MEK1 / 2 and ERK1 / 2 without altering GH receptor levels or GH induced phosphorylation / activation of JAK 2 and Raf 1 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
OBJECTIVE : We examined efficacy of the GH receptor antagonist , pegvisomant , in controlling gsp oncogene mediated GH excess and skeletal disease ( fibrous dysplasia of bone ) associated with MAS . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We report on a patient with acromegaly who developed severe drug induced hepatitis during combined treatment with the long acting somatostatin analog octreotide and the GH receptor antagonist pegvisomant . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
CONTEXT : GH insensitivity can be caused by defects in the GH receptor ( GHR ) or in the postreceptor signaling pathway . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The use of bromocriptine , cabergoline and octreotide , or the combination of these , has shown variable results , whereas pegvisomant , a GH receptor antagonist , is a new promising option , although not yet used in patients with MAS . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
DNA obtained from the blood cells of 88 adolescent patients with short stature , with low blood serum IGF 1 concentrations , normal growth hormone ( GH ) secretion and normal GH receptor ( GHR ) structure , was analyzed in the promoter region for the IGF 1 gene . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This study reports dual energy 10 ray absorptiometry ( DXA ) measurements of body composition and bone characteristics in young , adult , and aged long lived GH receptor knockout ( GHR KO ) and normal mice to determine the effects of GH resistance during aging . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
CONTEXT : The d3 / fl GH receptor ( d3 / fl GHR , exon 3 deleted / full length GHR ) has recently been associated with responsiveness to GH therapy . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In the 60 years since C H Li reported the isolation of bovine growth hormone ( GH ) , endocrinologists have seen the widespread use of human GH for statural disorders , the measurement of plasma GH as a diagnostic test , the full development of the somatomedin hypothesis and the molecular details of the function of the GH receptor responsible for regulating somatic growth and metabolism . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Differential expression of two GH receptor mRNAs following temperature change in rainbow trout ( Oncorhynchus mykiss ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We describe the first case of a 36 year old male patient with a somatotropin and thyreotropin secreting pituitary adenoma , co treated by a long acting releasing somatostatin analog ( Octreotide ) and a GH receptor antagonist ( Pegvisomant ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Pituitary glands were collected from 1 year old offspring for quantitative measurements of GH , GH receptor ( GH R ) , GH releasing hormone receptor ( GHRH R ) , somatostatin receptor subtype 2 and 5 , IGFI and IGFI receptor mRNA levels using a real time reverse transcriptase polymerase chain reaction . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The growth response to growth hormone ( GH ) treatment in children with isolated GH deficiency is independent of the presence of the exon 3 minus isoform of the GH receptor . ^^^ CONTEXT : A variant of the human GH receptor ( GHR ) lacks a 22 amino acid sequence derived from exon 3 ( d 3 GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The determinants for the hepatic growth hormone receptor binding and for the lactogenic receptor binding of human growth hormone are on the amino terminal fragments . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Studies with anti growth hormone receptor antibodies . ^^^ Antisera against a partially purified growth hormone receptor derived from rabbit liver were generated in guinea pigs . ^^^ Moreover , the binding of labeled growth hormone to membrane particles derived from liver of several species was also inhibited by the antisera , thus suggesting that immunological determinants of the growth hormone receptor of several species are similar . gamma Globulin fractions derived from the antisera were responsible for the inhibition . ^^^ The antireceptor sera will be useful probes in further characterization of the growth hormone receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Solubilization and partial purification of a growth hormone receptor from rabbit liver . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Since cytochalasin decreases the number of available insulin and human growth hormone receptor sites , cytochalasin sensitive microfilamentous structures appear to modulate the exposure of cell surface hormone receptors , while microtubules do not seem to be involved . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor ] . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Ovine placental lactogen is as reactive as human growth hormone with the human growth hormone receptor of cultured human ( IM 9 ) lymphocytes , which confirms the findings of Carr and Friesen with receptors of human liver . ^^^ We now also show that bovine and ovine growth hormones and ovine prolactin have reactivity for the human growth hormone receptor on IM 9 lymphocytes that is of the same order of magnitude ( 0 . 03 % ) as that previously reported for human placental lactogen . ^^^ In the present study we show that human and ovine placental lactogens , ovine prolactin , and bovine and ovine growth hormones also produce this effect on the human growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Technics of growth hormone receptor assay ] . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The folding topology of this domain is identical to that of the extracellular domains of the human growth hormone receptor , the second domain of CD 4 , and PapD . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Insulin like growth factors and their binding proteins in patients with growth hormone receptor deficiency : suggestions for new diagnostic criteria . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Treatment with recombinant human insulin like growth factor 1 of children with growth hormone receptor deficiency ( Laron syndrome ) . ^^^ Twenty seven patients ( 14 female , 13 male ; 3 pubertal ) with growth hormone receptor deficiency ( Laron syndrome ) were treated with recombinant insulin like growth factor 1 ( IGF 1 ) , 40 120 micrograms / kg body weight b . d . , for up to 12 months . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Mutation creating a new splice site in the growth hormone receptor genes of 37 Ecuadorean patients with Laron syndrome . ^^^ Growth hormone receptor gene sequences from an obligate heterozygote were amplified by the polymerase chain reaction and screened for mutations using denaturing gradient gel electrophoresis . ^^^ We conclude that the codon 180 nucleotide substitution probably causes Laron syndrome as translation of the observed , abnormally spliced growth hormone receptor transcript would lead to the synthesis of a receptor protein with an 8 amino acid deletion from the extracellular domain . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The cloning of a putative growth hormone receptor ( GH R ) cDNA has opened new approaches for the understanding of the molecular basis of GH insensitivity in humans . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Developmental expression of hepatic growth hormone receptor and insulin like growth factor 1 mRNA in the chicken . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Variants of the 5 ' untranslated sequence of human growth hormone receptor mRNA . ^^^ The human growth hormone receptor ( GHR ) gene was proposed to contain multiple 5 ' noncoding exons ( Leung et al . , 1987 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Molecular cloning of the bovine prolactin receptor and distribution of prolactin and growth hormone receptor transcripts in fetal and utero placental tissues . ^^^ Examination of the distribution of prolactin and growth hormone receptor transcripts at mid pregnancy by semi quantitative reverse transcriptase polymerase chain reaction showed that both are widespread in bovine fetal and placental tissues . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The prolactin receptor ( Prlr ) and growth hormone receptor ( Ghr ) genes and the Moloney murine leukemia virus integration 2 ( Mlvi 2 ) locus were mapped to mouse chromosome 15 and human chromosome 5 bands p 12 p14 . ^^^ To examine the potential relationship between Mlvi 2 and the genes encoding the growth hormone receptor and the prolactin receptor , we determined the chromosomal location of all three loci in the rat , using a panel of rat mouse somatic cell hybrids , and in the mouse , using a panel of ( C57BL / 6J 10 Mus spretus ) F 1 10 C57BL / 6J interspecific backcross mice . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The protein nature of the hepatic growth hormone receptor was revealed by the reduction of specific 125I labeled growth hormone binding after treatment of hepatic membranes with trypsin and chymotrypsin . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The topology is more similar to that of domain 2 of CD 4 , PapD , and the extracellular domain of the human growth hormone receptor than to that of immunoglobulin C domains . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
OBJECTIVE : Growth hormone receptor status was assessed in children with idiopathic short stature by evaluating plasma growth hormone binding protein before and under GH therapy . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Abnormal growth hormone receptor gene expression in the sex linked dwarf chicken . ^^^ We examined the effect of the dwarfing gene on body weight , hepatic GH binding activity , and the structure and expression of the growth hormone receptor ( GHR ) gene in two different lines of sex linked dwarf ( SLD ) broiler chickens . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The chronicle of growth hormone receptor deficiency ( Laron syndrome ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Clinical and biochemical characteristics of growth hormone receptor deficiency ( Laron syndrome ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Molecular biology of growth hormone receptor dysfunction . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Point mutations in the growth hormone receptor gene of patients with Laron syndrome . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Total RNA hybridized with a 32P labelled rat growth hormone receptor cRNA probe revealed one major transcript with an estimated size of 4 . 5 kb and one minor transcript with an estimated size of 1 . 3 kb . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of growth hormone receptor by immunocytochemistry in rat molar root formation and alveolar bone remodeling . ^^^ This study reports the distribution of growth hormone receptor / binding protein in developing rat molars and adjacent alveolar bone by immunocytochemistry using well characterized anti growth hormone receptor monoclonal antibodies . ^^^ However , growth hormone receptor immunoreactivity was associated primarily with the cytoplasm of odontogenic and osteogenic cells forming their respective matrices . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have found that the overall intron exon organization of the murine IL 4R gene is markedly similar to that of the murine erythropoietin receptor ( m epoR ) and the human interleukin 2 receptor beta chain ( hIL 2R beta ) , as well as the human growth hormone receptor ( hGhR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Rational design of potent antagonists to the human growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Total RNA from several adult ( 6 18 month old ) rabbit tissues was characterized using an oligonucleotide probe derived from the extracellular domain of the nucleotide sequence of the rabbit growth hormone receptor ( GH R ) cDNA . ^^^ Developmental expression of the growth hormone receptor gene in rabbit tissues . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Tissue specific developmental regulation of the messenger ribonucleic acids encoding the growth hormone receptor and the growth hormone binding protein in rat fetal and postnatal tissues . ^^^ Tissue responsiveness to growth hormone is likely to be regulated by local concentrations and availability of the membrane bound growth hormone receptor ( GHR ) and perhaps by the actions of the soluble growth hormone binding protein ( GHBP ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Immunocytochemical localization of growth hormone receptor in rat maxillary teeth . ^^^ Five microns paraffin sections of the growing end of maxillary incisors and molars were cut , deparaffinized and incubated with mouse anti growth hormone receptor antibodies or control antibodies . ^^^ The presence of growth hormone receptor / binding protein in tooth cells at different stages of their development indicates that growth hormone may influence cell proliferation , differentiation and differentiated functions of ameloblasts , odontoblasts and cementoblasts independent of a systemic mediator , and thus may be involved in stimulating odontogenesis directly . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
All four cell lines constitutively expressed the mRNA for the gamma , alpha , and beta receptors for retinoic acid ( RA ) , the growth hormone receptor , pro alpha 1 ( 1 ) collagen , osteonectin , bone proteoglycan 1 , and bone morphogenetic proteins ( BMP ) 1 and 2A . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Renal insulin like growth factor 1 and growth hormone receptor binding in experimental diabetes and after unilateral nephrectomy in the rat . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Studies on tilapia hepatic growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Regulation of human growth hormone receptor gene expression by human growth hormone in a human hepatoma cell line . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Identification and characterization of growth hormone receptor mRNA in the mammary gland . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Presence of prolactin receptors in eel liver and carp kidney and growth hormone receptor in eel liver . 1 . 125I labelled ovine prolactin and bovine growth hormone were used to test for the presence of prolactin and growth hormone receptors in membrane prepared from tissues of the white eel Anguilla japonica , the carp Ctenopharynogodon idellus and the ricefield eel Monopterus albus . 2 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Monoclonal antibodies to the pituitary growth hormone receptor by the anti idiotypic approach . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Rat insulinoma cells express both a 115 kDa growth hormone receptor and a 95 kDa prolactin receptor structurally related to the hepatic receptors . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Mutations in the growth hormone receptor ( GHR ) gene can cause growth hormone ( GH ) resistance . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Amplification using one sided polymerase chain reaction , cloning and determination of primary structure of 5 ' untranslated cDNA segments coding the somatogenic growth hormone receptor from rat liver ] . ^^^ The method of ligation mediated , single sided polymerase chain reaction was applied for the amplification of 5 ' untranslated regions of cDNA coding for somatogenic growth hormone receptor from rat liver . ^^^ Two variants of 5 ' untranslated sequences of growth hormone receptor cDNA corresponding to products of alternative splicing of pre mRNA were found . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor expression in the Dunning R 3327 prostatic carcinoma of the rat . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This finding , coupled with biochemical data on the complex in solution , indicates that the biologically significant dimerization of the growth hormone receptor is mediated through a single hormone molecule . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The cloning of a putative growth hormone receptor ( GH R ) cDNA has opened new approaches for the understanding of the molecular basis of GH insensitivity in humans . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The high affinity binding protein corresponds to the extracellular portion of the hepatic growth hormone receptor , whereas the low affinity binding protein appears unrelated to the receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
High level secretion of the extracellular domain of the human growth hormone receptor using a baculovirus system . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Dimerization of the extracellular domain of the human growth hormone receptor by a single hormone molecule . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Hybridization to a 32P labeled complementary DNA probe to the rabbit hepatic growth hormone receptor revealed two major labelled bands ( 3 . 5 and 1 . 2 kilobases ) and one minor band ( 2 . 4 kilobases ) in both cell types . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Comparison of the effects of hypertonic sucrose and intracellular potassium depletion on growth hormone receptor binding kinetics and down regulation in IM 9 cells : evidence for a sequential block of receptor mediated endocytosis . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Purification of a rabbit liver protein via its ability to bind GH has allowed the isolation of a cDNA encoding a putative human growth hormone receptor that belongs to a new class of transmembrane receptors . ^^^ We have previously shown that this putative growth hormone receptor gene is genetically linked to Laron dwarfism , a rare autosomal recessive syndrome caused by target resistance to GH . ^^^ We have now identified three nonsense mutations within this growth hormone receptor gene , lying at positions corresponding to the amino terminal extremity and causing a truncation of the molecule , thereby deleting a large portion of both the GH binding domain and the full transmembrane and intracellular domains . ^^^ Recurrent nonsense mutations in the growth hormone receptor from patients with Laron dwarfism . ^^^ Not only do these results confirm the growth promoting activity of this receptor but they also suggest that CpG doublets may represent hot spots for mutations in the growth hormone receptor gene that are responsible for hereditary dwarfism . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A systematic mutational analysis of hormone binding determinants in the human growth hormone receptor . ^^^ A mutational strategy is presented that allowed us to identify hormone binding determinants in the extracellular portion of the human growth hormone receptor ( hGHbp ) , a 238 residue protein with sequence homology to a number of cytokine receptors . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Differences in hepatic growth hormone receptor binding during development of normal and dwarf chickens . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Elevated plasma growth hormone ( GH ) levels despite diminished growth suggest GH resistance , which may be due in part to a decreased expression of the growth hormone receptor at the cell membrane . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of the growth hormone receptor gene in insulin producing cells . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Chromatographic fractions derived from snake pituitary and which possessed potent growth hormone receptor binding activity were devoid of prolactin receptor binding activity , suggesting the existence of distinct prolactin like and growth hormone like substances in snake pituitary . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
It is concluded that growth hormone mediates diacylglycerol production in Ob 1771 cells by means of phosphatidylcholine breakdown involving a phospholipase C which is likely coupled to the growth hormone receptor via a pertussis toxin sensitive G protein . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Recent advances in molecular genetics of the growth hormone receptor ] . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Regulation of the cell surface growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Regulation of growth hormone receptor turnover by growth hormone . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Absence of growth hormone receptor in hepatocellular carcinoma and cirrhotic liver . ^^^ To learn whether the growth hormone receptor is present in human hepatocellular carcinoma , we used radioreceptor assays in samples of human hepatocellular carcinoma . ^^^ The study results showed that the affinity constant and capacity of high affinity growth hormone receptor in normal liver tissues were 6 . 6 + / 2 . 0 10 10 ( 10 ) mol / L 1 ( mean + / SE , n = 7 ) and 20 . 7 + / 11 . 5 fmol / mg protein , respectively . ^^^ The affinity constant and capacity of low affinity growth hormone receptor in normal liver tissues were 8 . 9 + / 3 . 3 10 10 ( 9 ) mol / L 1 and 64 . 7 + / 32 . 1 fmol / mg protein , respectively . ^^^ The absence of growth hormone receptor in human hepatocellular carcinoma and cirrhotic liver samples may explain the absence of growth hormone in the stimulation of hepatoma growth and the decrease of somatomedin levels in cirrhosis . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The little women of Loja growth hormone receptor deficiency in an inbred population of southern Ecuador . ^^^ We describe an inbred population with a high incidence of growth hormone receptor deficiency resulting in a clinical picture resembling Laron type dwarfism but differing principally in showing a marked predominance of affected females . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Porcine growth hormone receptor cDNA sequence . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor and binding protein . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Part sequencing ( 101 residues ) revealed 34 % identity with the rabbit liver growth hormone receptor , providing support for the existence of a new class of transmembrane receptors regulating growth and lactation . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Cloning and in vivo expression of bovine growth hormone receptor mRNA . ^^^ These fractions were then probed for growth hormone receptor mRNA using solution hybridization nuclease protection assays performed on isolated RNA . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The differences are likely explained by the presence in non primate mammals of more than one type of growth hormone receptor with varied specificities . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Engineering human prolactin to bind to the human growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To test our system , rabbits were immunized with model peptides representing sequences of the putative rabbit growth hormone receptor and several HLA DQ beta chain molecules . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Prolactin receptor ( PRLR ) and growth hormone receptor ( GHR ) are encoded by members of a gene family containing regions of identical sequences . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The growth hormone receptor ( GHR ) and growth hormone binding protein ( GH BP ) expression were characterized in liver nodules and hepatomas from male Wistar rats . ^^^ Decreased expression of the growth hormone receptor and growth hormone binding protein in rat liver nodules . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The human growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This phenomenon was probably caused by the low expression of human growth hormone receptor in hepatoma tissues . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The human liver growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The growth hormone receptor gene in the African pygmy . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Recently , a larger form of the receptor has been evidenced in rabbit , and man , which presents some partial structural homology with the sequence of the growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Avian growth hormone receptor assay : use of chicken and turkey liver membranes . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The high affinity growth hormone binding protein is a fragment of the growth hormone receptor and may be an indicator of the number of receptors in tissues . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Characterization of the human growth hormone receptor gene and demonstration of a partial gene deletion in two patients with Laron type dwarfism . ^^^ Several lines of evidence suggest that this disease is caused by a defect in the growth hormone receptor . ^^^ Characterization of the growth hormone receptor gene from nine patients with Laron type dwarfism shows that two individuals have a deletion of a large portion of the extracellular , hormone binding domain of the receptor gene . ^^^ Thus , we provide direct evidence that Laron type dwarfism can result from a defect in the structural gene for the growth hormone receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor and serum binding protein : purification , cloning and expression . ^^^ A putative growth hormone receptor from rabbit liver and the growth hormone binding protein from rabbit serum have the same amino terminal amino acid sequence , indicating that the binding protein corresponds to the extracellular hormone binding domain of the liver receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In spite of the fact that the prolactin receptor has a much shorter cytoplasmic region than the growth hormone receptor , there is strong localized sequence identity between these two receptors in both the extracellular and cytoplasmic domains , suggesting that the two receptors originated from a common ancestor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In addition , the sequence identity of this form of prolactin receptor with the growth hormone receptor is extended in the cytoplasmic domain . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The bGH released from the fusion protein retains anti bGH immunoreactivity as well as the ability to bind to growth hormone receptor in vitro . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The human fat cell growth hormone receptor recognized neither bovine , ovine or rat GH nor human prolactin or placental lactogen . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Low circulating somatomedin C / insulin like growth factor 1 in insulin dependent diabetes and malnutrition : growth hormone receptor and post receptor defects . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
However , the differences seen in the intact forms of the growth hormone receptor were also present in the deglycosylated receptors . ^^^ The relationship between the three forms of the growth hormone receptor was further investigated by comparing the fragments produced by proteolytic digestion of the cross linked receptors with Staphylococcus aureus protease and endoproteinase Lys C . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Effects of glycosylation inhibitors on human growth hormone receptor in cultured human lymphocytes . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Detection of two growth hormone receptor mRNAs and primary translation products in the mouse . ^^^ Two mouse growth hormone receptor primary translation products of Mr 95 , 900 and 31 , 800 were identified from in vitro translated late pregnant mouse liver mRNA . ^^^ RNA isolated from mouse liver was translated in a rabbit reticulocyte lysate system containing [ 35S ] methionine , and the growth hormone receptor primary translation products were identified by immunoprecipitation with anti mouse growth hormone receptor antiserum followed by sodium dodecyl sulfate / PAGE and fluorography . ^^^ Northern ( RNA ) blot analysis of mouse liver and adipose tissue RNA with a rabbit growth hormone receptor cDNA probe revealed two hybridizing mRNAs of approximately 3 . 9 and 1 . 2 kilobases . ^^^ These results suggest a mechanism for the generation of both the heterogeneous forms of the growth hormone receptor identified in mouse liver membrane preparations and the mouse serum growth hormone binding protein . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Immunochemical similarity of the human plasma growth hormone binding protein and the rabbit liver growth hormone receptor . ^^^ We probed the ( immunochemical ) relationship between the recently discovered growth hormone binding protein in human plasma and the growth hormone receptor using monoclonal and polyclonal antibodies raised against rabbit liver growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Rabbit liver growth hormone receptor and serum binding protein . ^^^ A putative growth hormone receptor from detergent solubilized rabbit liver membranes and the growth hormone binding protein from rabbit serum have been purified 59 , 000 and 400 , 000 fold , respectively , primarily by affinity chromatography . ^^^ The amino terminal sequences of the liver growth hormone receptor and the serum binding protein were found to be the same , indicating that the binding protein corresponds to the extracellular domain of the liver receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Isolation of two molecular weight variants of the mouse growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Structure and proteolysis of the growth hormone receptor on rat hepatocytes . 125I Labeled human growth hormone is isolated in high molecular weight ( Mr ) ( 300 , 000 , 220 , 000 , and 130 , 000 ) and low molecular weight complexes on rat hepatocytes after affinity labeling . ^^^ Reduction of interchain disulfide bonds in the growth hormone receptor did not alter its elution from gel filtration columns , but intact , high molecular weight receptor constituents were separated from lower molecular weight degradation products . ^^^ Digestion of affinity labeled growth hormone receptor complexes with neuraminidase increased the mobility of receptor constituents on sodium dodecyl sulfate polyacrylamide gel electrophoresis . ^^^ These observations show that the growth hormone receptor is degraded by hepatic serine proteinases to low molecular weight degradation products which can be separated from intact receptor by gel filtration . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
High performance liquid chromatographic system for the rapid purification of growth hormone receptor in rabbit livers . ^^^ A system consisting of high performance affinity chromatography and size exclusion chromatography has been developed for the rapid purification and isolation of relatively labile membrane proteins , such as growth hormone receptor . ^^^ The crude membrane sample containing growth hormone receptor was obtained from rabbit livers by ultracentrifugation , followed by solubilization with Triton 10 100 . ^^^ After removal of unretained proteins , the fraction containing the growth hormone receptor was eluted with 6 M urea solution . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor cloned . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Alteration by concanavalin A of the slow dissociable component in the human growth hormone receptor interaction . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Interconversion between different states of affinity of the human growth hormone receptor on rat hepatocytes : effects of fractional site occupancy on receptor availability . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
One possible explanation for the data is that growth hormone receptor from liver is taken up by lymphocytes and rapidly released again , thus , contributing to the hormonal receptor economy in humans . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These results demonstrate directly that bromocriptine does not change the form or receptor reactive properties of plasma hGH and , further , that the drug does not alter at least one form of human growth hormone receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This effect is specific for the insulin receptor as growth hormone receptor concentration decreases . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Molecular dissection of the growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
On the basis of this probability function as well as a comparison of G CSF to the crystal structure of human growth hormone ( hGH ) complexed with the extracellular domain of the human growth hormone receptor ( hGHbp ) , residues that contribute to potential G CSF receptor binding sites are identified . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This type of growth hormone insensitivity is caused by defects in the growth hormone receptor gene . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Nutritional regulation of growth hormone receptor gene expression . ^^^ The role of energy intake in regulating growth hormone receptor ( GHR ) gene expression has been assessed in young growing pigs living at thermal neutrality ( 26 degrees C ) for a 4 wk period . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Insulin like growth factor and growth hormone receptor in nephrotic rats . ^^^ Hepatic growth hormone receptor ( GHr ) mRNA in the nephrotic rats averaged 19 % of that of the control ( P < 0 . 001 ) and 27 % of that of the pair fed rats ( P < 0 . 001 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The molecular distribution of insulin like growth factor 1 ( IGF 1 ) and IGF 2 among the IGF binding proteins ( IGFBPs ) was studied before and during IGF 1 therapy in Ecuadorean adults with growth hormone receptor deficiency ( GHRD ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Functional expression of a mouse growth hormone receptor cDNA in transfected mouse L cells . ^^^ A cDNA encoding a full length mouse ( m ) growth hormone receptor ( GHR ) derived from 3T3 F442A cells was amplified by RT PCR and cloned into a mammalian expression vector . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
BACKGROUND : Interleukin 2 ( IL 2 ) and interleukin 4 ( IL 4 ) are members of the four helix bundle family of cytokines , whose receptors show similarity to each other and to the growth hormone receptor fold . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The anterior pituitary specific transcription factor , Pit 1 , activates prolactin , growth hormone , TSH beta , growth hormone receptor genes and autoregulates the pit 1 gene . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The fact that a period of hormone deprivation is needed for significant hormone triggered receptor phosphorylation indicates that the mammary gland receptor exists in a largely desensitized state in vivo , analogous to the related growth hormone receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Compared with that of controls , negative energy balance increased growth hormone in serum but decreased IGF 1 in serum and the abundance of mRNA for growth hormone receptor and IGF 1 in liver . ^^^ In contrast , diet did not affect the abundance of mRNA for the growth hormone receptor or IGF 1 in luteal tissue . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Two days after injury , growth hormone receptor mRNA and IGF 1 mRNA levels fell approximately 9 to 33 % of control values . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor messenger ribonucleic acid expression in leiomyoma and surrounding myometrium . ^^^ We evaluated the presence of growth hormone receptor messenger ribonucleic acid in the human uterus and leiomyomas to investigate whether growth hormone might act directly rather than by hepatic generation of insulin like growth factor 1 . ^^^ We used a digoxigenin labeled oligoprobe sharing no homology to the growth hormone binding protein or to the prolactin receptor , to investigate whether growth hormone receptor messenger ribonucleic acid was present in tissue sections or amplified complementary deoxyribonucleic acid from leiomyoma and the surrounding myometrium . ^^^ RESULTS : The ratios of growth hormone receptor / reduced glyceraldehyde phosphate dehydrogenase in leiomyomas and the surrounding myometrium as assessed by densitometry analysis of polymerase chain reaction products were similar and were not altered by gonadotropin releasing hormone agonist treatment . ^^^ In situ hybridization localized the growth hormone receptor messenger ribonucleic acid to the nuclei and cytoplasm of leiomyoma and myometrium . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Identification of phenylalanine 346 in the rat growth hormone receptor as being critical for ligand mediated internalization and down regulation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Unlike the class 1 growth hormone receptor complex , the two interferon gamma receptors do not interact with one another and are separated by 27 A . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The membrane proximal region of the cytoplasmic domain of the growth hormone receptor is involved in the activation of Stat 3 . ^^^ Growth hormone receptor ( GHR ) signaling involves activation of the Janus Kinases ( Jak ) and of Stat proteins ( signal transducers and activators of transcription ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor . ^^^ The growth hormone receptor ( GHR ) belongs to the family of the prolactin and cytokine receptors . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The granulocyte colony stimulating factor receptor ( G CSF R ) and growth hormone receptor ( GH R ) belong to the cytokine receptor family and have some similarity in the cytokine receptor homologous ( CRH ) domain of the extracellular region . ^^^ Signal transduction mediated by growth hormone receptor and its chimeric molecules with the granulocyte colony stimulating factor receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Attempts to screen for RFLPs in the growth hormone receptor gene and in the insulin like growth factor 1 gene were unsuccessful . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Serum profiles of insulin like growth factors and their binding proteins in adults with growth hormone receptor deficiency treated with insulin like growth factor 1 . ^^^ Six adult patients with growth hormone receptor deficiency ( GHRD ) ( 2 men , 4 women ) with an identical defect in the growth hormone receptor ( GHR ) gene , were treated with recombinant human insulin like growth factor 1 ( IGF 1 ) , 40 micrograms / kg s . c . twice daily , for 7 days . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The growth hormone receptor messenger ribonucleic acid present in ovine fetal liver is a variant form . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In order to establish whether the prolactin activated transcription factor Stat 5 ( mammary gland factor ) is also activated by growth hormone , nuclear extracts were prepared from COS 7 cells transiently expressing transfected Stat 5 and growth hormone receptor cDNA . ^^^ In other experiments nuclear extracts from growth hormone treated Chinese hamster ovary cells stably expressing transfected growth hormone receptor cDNA and liver from growth hormone treated hypophysectomized rats were used for gel electrophoresis mobility shift analyses . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The impaired growth induced by zinc deficiency in rats is associated with decreased expression of the hepatic insulin like growth factor 1 and growth hormone receptor genes . ^^^ This study was conducted to determine whether dietary zinc status affects the expression of the insulin like growth factor 1 and growth hormone receptor / growth hormone binding protein genes in the liver of growing rats . ^^^ The growth hormone receptor mRNA levels of zinc deficient and pair fed rats were 17 and 50 % and their growth hormone binding protein mRNA levels were 46 and 65 % those of the ad libitum fed rats . ^^^ In summary , zinc deficiency markedly decreases expression of the insulin like growth factor 1 and growth hormone receptor genes . ( ABSTRACT TRUNCATED AT 250 WORDS ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Extracellular hormone binding domains of human growth hormone receptor were produced by genetic engineering methods . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Structure of the growth hormone receptor complex and mechanism of receptor signaling . ^^^ The structure of the growth hormone receptor complex discussed here is the first such system to be studied at the level of atomic detail and provides unique information that elucidates the mechanism of signal transduction of an important receptor family . ^^^ The growth hormone receptor is a single pass receptor , with an extracellular protein domain , a transmembrane domain and an intracellular protein domain . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone insensitivity syndrome due to point deletion and frame shift in the growth hormone receptor . ^^^ By direct amplification and sequencing of genomic DNA by the polymerase chain reaction , we have identified a unique 2 base deletion in the growth hormone receptor gene of a patient with extreme short stature and growth hormone insensitivity ( Laron ) syndrome . ^^^ We found a deletion of bases 118 119 in exon 4 , which corresponds to the extracellular domain of the growth hormone receptor . ^^^ Since this mutation encodes a frameshift in the amino acid sequence and a stop codon relatively early in the translation of the growth hormone receptor , we conclude that this deletion caused the growth hormone insensitivity in this patient . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To investigate signal transduction by c Mpl , a chimeric receptor , composed of the extracellular domain of human growth hormone receptor and the intracellular domain of c Mpl , was introduced into the interleukin 3 dependent cell line Ba / F3 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The present experiments in Long Evans rats were carried out to investigate how deflazacort administration affected the growing rat , especially in relation to hepatic insulin like growth factor 1 ( IGF 1 ) and growth hormone receptor ( GHR ) messenger ribonucleic acid ( mRNA ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Facial morphometry of Ecuadorian patients with growth hormone receptor deficiency / Laron syndrome . ^^^ Facial morphometry using computerised image analysis was performed on patients with growth hormone receptor deficiency ( Laron syndrome ) from an inbred population of southern Ecuador . ^^^ Patients with growth hormone receptor deficiency showed significant decreases in measures of vertical facial growth as compared to unaffected relatives and unrelated persons with short stature from other causes . ^^^ This report validates and quantifies the clinical impression of foreshortened facies in growth hormone receptor deficiency . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The extracellular interferon gamma receptor alpha chain ( IFN gamma R ) is believed to comprise two discrete approximately 110 amino acid immunoglobulin like domains , perhaps similar to those seen in the crystal structure of the extracellular human growth hormone receptor [ De Vos , A . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A single arginine residue determines species specificity of the human growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Rat growth hormone receptor / growth hormone binding protein mRNAs with divergent 5 ' untranslated regions are expressed in a tissue specific manner . ^^^ In the rat , the growth hormone receptor ( GH R ) gene generates two transcripts , one encoding the transmembrane GH R , and a shorter one encoding the GH binding protein ( GH BP ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
An exon encoding the mouse growth hormone binding protein ( mGHBP ) carboxy terminus is located between exon 7 and 8 of the mouse growth hormone receptor gene . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In vitro mutagenesis of growth hormone receptor Asn linked glycosylation sites . ^^^ Site directed mutagenesis was used to replace asparagine ( Asn ) residues with glutamine ( Gln ) at the five potential N linked glycosylation sites located at positions 28 , 97 , 138 , 143 , and 182 in the extracellular domain of the porcine growth hormone receptor ( pGHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Ligand induced internalization and phosphorylation dependent degradation of growth hormone receptor in human IM 9 cells . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
An XbaI RFLP at the porcine growth hormone receptor locus ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The enhancement of the extracellular carboxyl terminal domain of human growth hormone receptor on growth hormone dependent responses of 3T3 F442A cells . ^^^ We have expressed the carboxyl terminal domain ( C domain ) of the cytokine receptor homologous ( CRH ) region of human growth hormone receptor ( hGHR ) as a protein fused with maltose binding protein ( MBP ) in E . coli . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor and binding protein : distribution and function . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In order to define the promoter regions responsible for this effect and to characterize the transcription factors involved , we have performed gel electrophoresis mobility shift assays on nuclear extracts from cell lines transfected with growth hormone receptor cDNA . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor structure , dimerization and function . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Body changes in adolescent patients with growth hormone receptor deficiency receiving recombinant human insulin like growth factor 1 and luteinizing hormone releasing hormone analogue : preliminary results . ^^^ Auxological and body composition changes were studied in three adolescent patients ( 2 female , 1 male ) with growth hormone receptor deficiency ( GHRD ) given insulin like growth factor 1 ( IGF 1 ) , 120 micrograms / kg s . c . twice daily , plus a monthly intramuscular injection of 7 . 5 mg of a luteinizing hormone releasing hormone ( LHRH ) analogue . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Heart rate increases in patients with growth hormone receptor deficiency treated with insulin like growth factor 1 . ^^^ Cardiac function was measured in 16 prepubertal Ecuadorean patients with growth hormone receptor deficiency given insulin like growth factor 1 ( IGF 1 ) during part of a clinical trial . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor deficiency in two siblings from South Africa . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Bell ' s palsy after onset of insulin like growth factor 1 therapy in a patient with growth hormone receptor deficiency . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Transient bilateral papilloedema in a 10 year old boy treated with recombinant insulin like growth factor 1 for growth hormone receptor deficiency . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Interaction of the growth hormone receptor cytoplasmic domain with the JAK 2 tyrosine kinase . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of two isoforms of the human growth hormone receptor in normal liver and hepatocarcinoma . ^^^ In man , two isoforms of growth hormone receptor ( GHR ) have been reported . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The role of the WSXWS equivalent motif in growth hormone receptor function . ^^^ To examine the role of the WS equivalent sequence ( Y222GEFS226 ) in the function of the growth hormone receptor , each residue was mutated to alanine or to the WS consensus sequence . ^^^ The crystal structure of the ligand occupied extracellular domain of growth hormone receptor indicates that Tyr 222 and Ser 226 have important interactions within the second beta barrel domain , providing a structural basis for our results . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Differential expression of surface membrane growth hormone receptor on human peripheral blood lymphocytes detected by dual fluorochrome flow cytometry . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Thyroid hormone status correlates inversely with expression of the growth hormone receptor gene in rats immediately after birth . ^^^ To investigate the role of thyroid hormone in the expression of the gene encoding the growth hormone receptor ( GHR ) and growth hormone binding protein ( GHBP ) , fetal rats were made hypothyroid through the administration of the goitrogen methimazole to the mother . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Tissue specific regulation of the growth hormone receptor gene in streptozocin induced diabetes in the rat . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Mouse growth hormone binding protein and growth hormone receptor transcripts are produced from a single gene by alternative splicing . ^^^ Serum contains a soluble growth hormone binding protein which is produced in some species by proteolytic cleavage of the extracellular domain of the growth hormone receptor . ^^^ The hypothesis that a growth hormone binding protein messenger RNA is produced in other species by alternative splicing of nascent growth hormone receptor transcripts was confirmed by analysis of the mouse growth hormone receptor gene . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Preparation of monoclonal antibodies for immunoblotting human growth hormone receptor and growth hormone binding protein . ^^^ Monoclonal anti peptide antibodies against the extracellular domain of human growth hormone receptor ( hGHR ) were prepared . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The isolation of growth hormone receptor ( GHR ) cDNA clones has made possible the transfection of GHRs into cultured cells . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Overexpression of the short form of the growth hormone receptor in 3T3 L 1 mouse preadipocytes . ^^^ In rodents , the gene for the growth hormone receptor ( GHR ) gives rise to two mRNA transcripts encoding two proteins : a larger membrane spanning receptor ( GHRL ) and a smaller isoform , GHRs that consists of the extracellular domain and a unique hydrophilic carboxyl terminus . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Regulation of growth hormone receptor and binding protein expression in domestic species . ^^^ Growth hormone receptor ( GHR ) expression has been analyzed at the RNA level . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Signal transduction by the growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor / binding protein : physiology and function . ^^^ Soluble truncated forms of the growth hormone receptor ( GHR ) are present in the circulation of many species and are also produced by many tissues / cell types . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The structure and regulation of expression of the mouse growth hormone receptor and binding protein . ^^^ The mouse growth hormone receptor ( mGHR ) and the mouse growth hormone binding protein ( mGHBP ) are products of a single gene which are generated by alternative splicing . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Bovine PRLR ECD ( bPRPL ECD amino acids 1 210 ) and human growth hormone receptor ECD ( hGHR ECD amino acids 1 246 ) were also prepared using E . coli expression system . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The significance of the short form of the growth hormone receptor in rat adipocytes . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Comparison of tissue factor with the extracellular domain of the growth hormone receptor , which belongs to the same receptor superfamily , shows that the relative orientation between these domains as well as the domain domain interface is very different . ^^^ These differences have dramatic consequences for the residues in tissue factor that are homologous to the binding determinants of the growth hormone receptor . ^^^ The structure shows that the binding site is located in the domain domain interface region but on the opposite side of the molecule compared to the growth hormone receptor , with the binding determinants residing on beta strands rather than on loops . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This is a different binding paradigm from that used by either antibodies or the growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of functional growth hormone receptor in a mouse L cell line infected with recombinant vaccinia virus . ^^^ The growth hormone receptor is a member of a large family of receptors including the receptors for prolactin and interleukins . ^^^ Upon binding to one molecule of growth hormone two growth hormone receptor polypeptides dimerize . ^^^ We have expressed the rabbit growth hormone receptor DNA in transfected mouse L cells infected with polymerase T 7 producing vaccinia virus . ^^^ The growth hormone receptor was synthesized as a 85 kDa protein and transported to the cell surface . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
First , on the basis of the crystal structure of the ligand bound , homodimeric growth hormone receptor ( GH R ) and sequence alignment between the GH R and EPO R , we identified residues of the EPO R which may be involved in intersubunit contacts in an EPO R homodimer . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Review of studies on growth hormone receptor insufficiency ( Larone ' s syndrome ) ] . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Clinical and biochemical characteristics of growth hormone receptor insufficiency ( Larone ' s syndrome ) ] . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Therapy with recombinant human insulin like growth factor 1 in children with growth hormone receptor insufficiency ( Larone ' s syndrome ) ] . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In situ hybridization mapping of the growth hormone receptor ( GHR ) gene assigns a linkage group ( C 9 , FS , GHR , and S 0105 ) to chromosome 16 in pigs . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Pharmacokinetics of recombinant human insulin like growth factor 1 given subcutaneously to healthy volunteers and to patients with growth hormone receptor deficiency . ^^^ The pharmacokinetics of recombinant human insulin like growth factor 1 ( rhIGF 1 ) were studied in healthy volunteers and in patients with growth hormone receptor deficiency ( GHRD ; Laron syndrome ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor regulation in growth hormone deficient dwarf rats . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A novel in vitro model for studying signal transduction and gene regulation via the growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In the present study , the expression of the growth hormone receptor ( GH R ) mRNA was studied in the rat ovary using an RNA probe corresponding to a part of the extracellular domain of the GH R . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Sex dimorphism in expression of alternative variants of mRNA for the growth hormone receptor in rat liver ] . ^^^ Two alternative variants of 5 ' untranslated sequence of the rat growth hormone receptor ( GHR ) mRNA were previously described . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The structure of the growth hormone receptor and a sequence of the chemical event leading to the expression of the effect of growth hormone , on cellular function , proliferation and differentiation , are reviewed in relation to ligands for the superfamily receptors . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Effect of metabolic acidosis on the expression of insulin like growth factor and growth hormone receptor . ^^^ To further our understanding of the growth failure in metabolic acidosis , we examined the insulin like growth factor ( IGF 1 and IGF 2 ) , the IGF binding protein 3 ( IGFBP 3 ) , and the hepatic IGF mRNA and growth hormone receptor mRNA in control , pair fed and acidotic rats . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Cytoplasmic sequences of the growth hormone receptor necessary for signal transduction . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone binding protein ( GHBP ) may be an important factor in the regulation of growth and might provide an indirect , relatively noninvasive means of predicting the status of hepatic growth hormone receptor ( GHR ) activity . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Residues contributing to ligand binding by tissue factor were identified in positions corresponding to ligand interactive residues in the growth hormone receptor and contact residues of other cytokine receptors , consistent with a conserved structural region for ligand interaction throughout the cytokine receptor family . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor ( GHR ) forms a complex with a tyrosine kinase , suggesting involvement of a ligand activated tyrosine kinase in intracellular signaling by growth hormone ( GH ) . ^^^ Identification of JAK 2 as a growth hormone receptor associated tyrosine kinase . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Ligand specific dimerization of the extracellular domain of the bovine growth hormone receptor . ^^^ Since bPL can not dimerize the bGHBP and yet it acts in part as a somatogen in vivo , homodimerization of the growth hormone receptor is apparently not essential for some biological responses signaled through this receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Functional characterization of the alternatively spliced , placental human growth hormone receptor . ^^^ As part of an effort to define the local effects of the placentally expressed members of the GH / Prl family of hormones on the placenta , we have identified an isoform ( hGHRd 3 ) of the growth hormone receptor expressed in the placental villi . hGHRd 3 mRNA differs from the liver GHR mRNA by the deletion of a 66 base pair segment encoding exon 3 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor and growth hormone binding protein messages in mouse placenta contain the exon analogous to human exon 3 . ^^^ Growth hormone receptor ( GHR ) encoding messages from the human placenta and other tissues have been recently characterized by several investigators . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This review describes the recent developments in the diagnosis and treatment of states of resistance to growth hormone based mainly on the studies performed on patients with an inborn molecular defect of the growth hormone receptor , ie , Laron syndrome . ^^^ Use of the polymerase chain reaction technique has facilitated the study of the defect , which in the large majority of patients resides in the extracellular domain of the growth hormone receptor . ^^^ The Pygmies are an inbred population in Africa , Asia , and Oceania who seemingly also have a defect in the growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of a functional porcine growth hormone receptor cDNA in mouse L cells . ^^^ Porcine ( p ) growth hormone receptor ( GHR ) complementary DNA ( cDNA ) has been cloned and the primary amino acid structure was deduced from the nucleotide sequence . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Developmental expression of the growth hormone receptor gene in the rat hypothalamus . ^^^ The ontogeny of growth hormone receptor ( GHR ) gene expression was studied in the rat hypothalamus . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The molecular basis for growth hormone receptor interactions . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression and binding properties of two isoforms of the human growth hormone receptor . ^^^ Two isoforms of the human growth hormone receptor mRNA , one containing exon 3 ( encoding an extracellular domain of the receptor ) , hGHR , and one excluding exon 3 , hGHRd 3 , have been described . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The growth hormone binding protein ( GHBP ) which circulates in plasma is a soluble short form of the membrane growth hormone receptor ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To evaluate the role of the hepatic growth hormone receptor in the decreased serum concentrations of insulin like growth factor 1 , serum levels of the high affinity growth hormone binding protein , which is qualitatively and quantitatively related to the hepatic growth hormone receptor , and of insulin like growth factor 1 were measured in 70 children and adolescents with Type 1 diabetes and 105 healthy control children . ^^^ Post growth hormone receptor defects or changes in the insulin like growth factor binding proteins probably contribute more to the lower serum levels of insulin like growth factor I . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The molecular analysis of growth hormone receptor has provided new medical insight on the results of growth hormone replacement therapy in persons with deficient growth . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The growth hormone receptor is a well characterized member of the cytokine receptor family . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Diverse growth hormone receptor gene mutations in Laron syndrome . ^^^ To better understand the molecular genetic basis and genetic epidemiology of Laron syndrome ( growth hormone insensitivity syndrome ) , we analyzed the growth hormone receptor ( GHR ) genes of seven unrelated affected individuals from the United States , South America , Europe , and Africa . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Treatment of carp liver membranes with either chymotrypsin or trypsin produced a decrease in the growth hormone binding activity , indicating that the growth hormone receptor on carp liver membrane is a protein . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Crystals of human growth hormone receptor complexes . ^^^ A single site human growth hormone mutant ( hGH [ G120R ] ) , which inhibits receptor dimerization , was used to produce single crystals , suitable for high resolution diffraction studies , of 1 : 1 complexes with the ligand binding domain of the growth hormone receptor ( hGHbp ) and of the prolactin receptor ( hPRLbp ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Within the growth hormone receptor , a cluster of extracellular amino acids forms a dimer interface domain that stabilizes ligand induced homodimers . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Detection of growth hormone receptor mRNA in an ovine choroid plexus epithelium cell line . ^^^ The expression of growth hormone receptor ( GHR ) mRNA in an ovine choroid plexus cell line ( SCP ) was studied . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Convenient desktop scale production of the extracellular domain of the human growth hormone receptor by an insect baculovirus secretion system using a protein free culture . ^^^ Expression of a gene encoding the extracellular domain of the human growth hormone receptor ( hGHR ED ) inserted into the genome of Autographa californica nuclear polyhedrosis virus was done using a desktop scale spinner culture . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor : structure and signal transduction . ^^^ The growth hormone receptor ( GHR ) belongs to the superfamily of transmembrane proteins that includes the prolactin receptor and a number of cytokine receptors . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Binding in the growth hormone receptor complex . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Ethanol did not alter growth hormone receptor binding , and exposure of tissue slices to ethanol did not influence the number of growth hormone receptors or the affinity of growth hormone for its receptor . ^^^ Our results demonstrate that ( 1 ) growth hormone is a potent acute regulator of IGF 1 mRNA and IGF 1 peptide release , ( 2 ) ethanol inhibits growth hormone induced protein synthesis and induction of IGF 1 gene expression , and ( 3 ) the inhibitory effects of ethanol on growth hormone occur without changing growth hormone receptor number or binding characteristics . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Responses of young energy restricted sheep to chronically administered insulin like growth factor 1 ( IGF 1 ) : evidence that IGF 1 suppresses the hepatic growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Comparison of the structure to that of the human growth hormone receptor , which belongs to a different class ( class 1 ) of the same cytokine receptor superfamily , shows that the structure of the individual domains is very similar but that the relative domain domain orientation differs greatly . ^^^ Mapping of residues important for biological activity on the structure shows that all these are located on Beta strands in a small number of distinct clusters , on the opposite side of the molecule compared to the ligand binding determinants of the growth hormone receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Moderate caloric restriction prevents the age related decline in growth hormone receptor signal transduction . ^^^ In this study , the effects of aging and long term caloric restriction on growth hormone receptor signal transduction were assessed in hepatic tissue to determine whether alterations in tissue responsiveness to growth hormone contribute to the decline in IGF 1 gene expression . ^^^ An increase in growth hormone receptor binding was observed in 31 month ad libitum fed animals ( p < . 01 ) compared to 10 or 17 month old animals ) , and this effect was partially attenuated by moderate caloric restriction . ^^^ Further analysis revealed that growth hormone receptor and JAK 2 kinase phosphorylation as well as mitogen activated protein ( MAP ) kinase activity were significantly lower in old animals compared to the adult or middle age groups ( p < . 05 ) . ^^^ Old caloric restricted animals demonstrated a significant increase in growth hormone receptor and JAK 2 kinase phosphorylation and MAP kinase activity in response to growth hormone . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
By using chimeric receptors consisting of the extracellular domain of growth hormone receptor and the transmembrane and cytoplasmic domain of gp 130 with progressive C terminal truncations , we showed that the membrane proximal 133 , but not 108 , amino acids of gp 130 could generate the signals for growth arrest , macrophage differentiation , down regulation of c myc and c myb , induction of junB and IRF 1 and Stat 3 activation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Cardiac insulin like growth factor 1 and growth hormone receptor expression in renal hypertension . ^^^ The aim of the present study was to investigate the role of insulin like growth factor 1 in the development of cardiac hypertrophy in two kidney , one clip hypertension by relating growth hormone receptor and insulin like growth factor 1 receptor mRNA levels to insulin like growth factor 1 gene transcription using a solution hybridization / RNase protection assay . ^^^ Furthermore , growth hormone receptor and insulin like growth factor 1 receptor gene expression increased specifically in the left ventricle of renal hypertensive rats ( P < . 05 and P < . 001 , respectively ) . ^^^ Left ventricular growth hormone receptor mRNA peaked 7 days after induction of renal artery stenosis . ^^^ These results show that insulin like growth factor 1 , growth hormone receptor , and insulin like growth factor 1 receptor mRNA increase in the pressure overloaded left ventricle of two kidney , one clip rats , suggesting a role for insulin like growth factor 1 and the growth hormone / insulin like growth factor 1 axis in the development of cardiac hypertrophy . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Mutations of the growth hormone receptor widening the search . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of exon 3 retaining and deleted human growth hormone receptor messenger ribonucleic acid isoforms during development . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Perinatal ontogeny of porcine growth hormone receptor gene expression is modulated by thyroid status . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Promotion of animal growth with a monoclonal antibody specific to growth hormone receptor . ^^^ A monoclonal antibody ( mAb ) , designated 2C3 , was raised against the growth hormone receptor ( GHR ) of rats . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In conjunction with previous immunohistochemical studies that show expression of growth hormone receptor and IGF 1 in developing teeth , these results provide evidence that both growth hormones and its mediator play a part in odontogenesis . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor deficiency ( Laron syndrome ) in black African siblings . ^^^ Non Caucasians with growth hormone receptor ( GHR ) deficiency / Laron syndrome among the approximately 180 recognised cases are rare , and include a Japanese and 3 African Americans . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Distinct cytoplasmic domains of the growth hormone receptor are required for glucocorticoid and phorbol ester induced decreases in growth hormone ( GH ) binding . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Analysis of the growth hormone receptor ( GHR ) gene in GH insensitivity syndrome revealed various mutations , mainly in the gene encoding the extracellular domain of GHR . ^^^ No correlation of growth hormone receptor gene mutation P561T with body height . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The ubiquitin conjugation system is required for ligand induced endocytosis and degradation of the growth hormone receptor . ^^^ Growth hormone receptor ( GHR ) cDNA was transfected into Chinese hamster ovary cells , which exhibit a temperature sensitive defect in ubiquitin conjugation ( CHO ts 20 ) , as well as into wild type cells ( CHO E 36 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Fetal and tumor specific regulation of growth hormone receptor messenger RNA expression in human liver . ^^^ Eight different 5 ' untranslated region variants of the human growth hormone receptor ( hGHR ) mRNA have been identified in adult liver ( V 1 V8 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of growth hormone receptor gene in rat hypothalamus . ^^^ Growth hormone receptor ( GHR ) mRNA expressing cells in the hypothalamus were observed using hybridization histochemistry in adult male rats . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
An immobilised peptide array identifies antibodies to a discontinuous epitope in the extracellular domain of the bovine growth hormone receptor . ^^^ Using an array of overlapping decapeptides representing the extracellular domain of the bovine ( b ) growth hormone receptor ( GHR ) we have mapped the continuous , dominant epitopes defined by five rabbit and one guinea pig polyclonal antisera to recombinant bovine growth hormone binding protein ( rbGHBP ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor ( GH R ) mRNA was expressed in avian skeletal muscle tissue and satellite cells in culture , and was capable of binding chicken growth hormone ( cGH ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Novel assays based on human growth hormone receptor as alternatives to the rat weight gain bioassay for recombinant human growth hormone . ^^^ In the HPRBC assay , rhGH is combined with an excess of the soluble extracellular domain of the recombinant human growth hormone receptor ( referred to as ' receptor ' in the discussion of the HPRBC assay ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Immunodominant regions of the extra cellular domain of the bovine growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Regulation of hepatic mRNA levels for the growth hormone receptor in rats with altered thyroid status . ^^^ In the rat , there is a single gene for the growth hormone receptor ( GHR ) , that is transcribed into two different sized mRNA transcripts following alternative splicing , one transcript codes for the GHR ( 4 . 0 4 . 5 kb ) and the other growth hormone binding protein ( GHBP ) ( 1 . 2 1 . 3 kb ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of aberrantly spliced growth hormone receptor mRNA in the sex linked dwarf chicken , Gifu 20 . ^^^ The structure and expression of the growth hormone receptor ( GHR ) gene have been studied in a sex linked dwarf ( SLD ) chicken strain , Gifu 20 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Structural and mutational analysis of affinity inert contact residues at the growth hormone receptor interface . ^^^ These studies emphasize that one can not infer binding free energy from the existence of contacts alone and further support the notion that only a small set of contacts are crucial for the human growth hormone receptor interaction . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In this study , the biological consequences of placing this novel amino acid in the polypeptide chain was examined with two proteins of known function : the rat growth hormone receptor and human thyroid hormone receptor beta 1 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The sequences were chosen according to the homology between hGM CSFR alpha and the growth hormone receptor ( GHR ) and correspond to the regions reported to form the binding site of the latter receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor mRNA was first detected by Northern blotting in the spleen , bursa of Fabricius , and thymus of domestic fowl . ^^^ In addition to the 4 . 4 kb transcript thought to encode the full length growth hormone receptor , smaller transcripts of 2 . 8 kb and 1 . 0 kb , which may encode growth hormone binding proteins , were also occasionally observed . ^^^ Further analysis using the polymerase chain reaction revealed that mRNA sequences encoding the extracellular and intracellular domains of the growth hormone receptor were present in all tissues and highly homologous with hepatic transcripts . ^^^ The distribution of growth hormone receptor / growth hormone binding protein immunoreactivity in these tissues would further suggest that growth hormone plays a major role in macrophage proliferation and / or activity and may indirectly affect lymphocyte maturation and storage via effects on thymic and splenic stromal cells . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Interactions of recombinant soluble prolactin receptors extracellular domains ( PRLR ECDs ) from rabbit , rat , and cow and human growth hormone receptor ECD with immobilized human growth hormone , several prolactins , and bovine placental lactogen were studied utilizing surface plasmon resonance . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A rise in histone 3 , which coincides with mitosis , was only seen after 70 % hepatectomy , indicating that after 90 % hepatectomy the response to growth stimulating factors is weak or delayed , supported by a delayed rise in cyclin d and low levels of growth hormone receptor mRNA . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The growth hormone receptor ( GHR ) , a member of the cytokine receptor superfamily that gives rise to a soluble and circulating counterpart ( GHBP ) , is the main target of Laron syndrome ( LS ) , a severe autosomal recessive dwarfism characterized by complete GH insensitivity . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
EE treatment also significantly increased the expression of c myc , and c jun , enhanced the levels of growth hormone receptor ( GHr ) mRNA in females and the levels of ER mRNA in males and `` feminized ' ' the expression of the GH regulated genes cytochrome P 450 ( CYP ) , 2C11 , CYP 2C12 , and GHr in male liver . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In rats and mice , it involves an alternatively spliced mRNA , whereas in rabbits , it involves limited proteolysis of the membrane bound growth hormone receptor ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Relationships of polymorphisms for growth hormone and growth hormone receptor genes with milk production traits for Italian Holstein Friesian bulls . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
An unusual case of growth hormone receptor deficiency syndrome . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Alternative splicing of exon 3 of the human growth hormone receptor is the result of an unusual genetic polymorphism . ^^^ Two isoforms of the human growth hormone receptor ( hGHR ) , which differ in the presence ( hGHRwt ) or absence ( hGHRd 3 ) of exon 3 , are expressed in the placenta . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Initial assignment of coordinates in the model of the p 40 subunit was based on established amino acid sequence homology between the second and third domains of p 40 and the human growth hormone receptor ( GHR ) and new observations of similarity between the first domain of p 40 and the N terminal domain of CD 4 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This was comparable to fold induction observed with the wild type long form rat prolactin receptor ( 6 . 37 + / 0 . 48 ) ; macaque growth hormone receptor was without effect . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
There was little effect of gender , hypophysectomy , or growth hormone replacement on CYP2C6 , growth hormone receptor , and growth hormone binding protein mRNAs . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Structural comparison of a portion of the rat and mouse growth hormone receptor / binding protein genes . ^^^ A portion of the rat growth hormone receptor ( GHR ) gene was cloned by PCR . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The 1 : 1 complex is remarkably similar to the native growth hormone receptor 1 : 2 complex . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Decreased growth hormone receptor expression in long bones from toothless ( osteopetrotic ) rats and restoration by treatment with colony stimulating factor 1 . ^^^ This study examined the distribution of growth hormone receptor ( GHR ) expression in tibias from normal and osteopetrotic tl / tl rats . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor activity is stimulated by insulin like growth factor binding protein 5 in rat osteosarcoma cells . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To investigate the effects of testosterone and estradiol ( E 2 ) on growth hormone receptor ( GH R ) gene expression , we measured GH R mRNA levels in relation to the changes of sex steroid concentrations in the normal male rabbits aged 1 12 months and after administration of testosterone or E 2 to castrated male rabbits . ^^^ Developmental changes and differential regulation by testosterone and estradiol of growth hormone receptor expression in the rabbit . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The growth hormone receptor ( GHR ) is a ubiquitinated cell surface protein . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Ontogeny of mRNA levels of IGFs , IGF type 1 and type 2 receptors ( IGFI R and IGFII R ) , IGFBP 1 and 3 ( IGFBPs ) and growth hormone receptor ( GHR ) were also examined by Northern blot analysis in liver , kidney and skeletal muscle of pig . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Jak 2 and STAT 1 colocalized in the proximal ends of presecretory and secretory stage ameloblasts , supporting work by others that growth hormone receptor is located at that site . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Induction of growth hormone receptor and insulin like growth factor 1 mRNA in aorta and caval vein during hemodynamic challenge . ^^^ In the present study , we applied hemodynamic challenge to study the growth response involving gene expression of insulin like growth factor 1 ( IGF 1 ) and growth hormone receptor ( GH R ) mRNA in aorta and caval vein . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In diabetic cortex and medulla , growth hormone receptor mRNA levels and IGF 1 and IGF 1 receptor mRNA and protein product levels were unchanged . ^^^ However , the lack of change in IGF 1 , IGF 1 receptor and growth hormone receptor gene expression and protein products after one week of diabetes argues against a role for IGF 1 in sustaining diabetic renal growth beyond the initial growth phase . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Just as importantly , hepatic growth hormone receptor expression and IGF 1 mRNA were blunted in metabolic acidosis . ^^^ Growth hormone receptor expression was significantly reduced in uremic acidotic rats . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Functional characterization of monoclonal antibodies specific to growth hormone receptor . ^^^ An attempt was made in this study to generate monoclonal antibodies ( mAb ) specific to recombinant rat growth hormone receptor ( GHR ) and subsequently to investigate their ability to act as biologically active ligands . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The biological actions of growth hormone ( GH ) are mediated through the growth hormone receptor ( GHR ) . ^^^ Isolation of a liver specific promoter for human growth hormone receptor gene . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Dynamic alterations in growth hormone receptor mRNA levels in rat brain during stress tolerance . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Conformational changes required in the human growth hormone receptor for growth hormone signaling . ^^^ Signaling to the cell is believed to require growth hormone receptor ( GHR ) dimerization , which occurs following binding of a single growth hormone molecule to each of two receptors . ^^^ We have developed human growth hormone receptor specific monoclonal antibodies , one of which was used here to characterize hormone / receptor interactions . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The recent assignment of growth hormone receptor gene to the short arm of chromosome 5 and the presence of several genes for growth factors and growth factor receptors on 5q raise interesting possibilities for the explanation of short stature in such cases . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
While the growth hormone receptor ( hGHR ) binds only hGH , hPrlR can interact with both hGH and hPrl . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A dominant negative mutation of the growth hormone receptor causes familial short stature . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Both chains belong to the superfamily of cytokine receptors characterized by a common structural feature , i . e . , the presence of at least two fibronectin like folds in the extracellular domain , which was first identified in the growth hormone receptor . ^^^ The present study was designed to define the assembly of the GMR complex at the molecular level through site directed mutagenesis guided by homology modeling with the growth hormone receptor complex . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In addition to the growth hormone receptor , the receptors for prolactin and erythropoietin enhanced gene transcription via the SPI 2 . 1 STAT responsive element , which indicates that this element is , on the other hand , not cytokine specific . ^^^ Activation of STAT 5 was also observed after growth hormone treatment of cells transfected with cDNA expression plasmids for several different truncated growth hormone receptor mutants , although this activation was less efficient than with the wild type receptor . ^^^ Point mutation of individual tyrosines in the growth hormone receptor intracellular domain to phenylalanines had no significant effect on signal transduction via STAT 5 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The growth hormone receptor ( GHR ) cDNA was cloned from the liver of Rhesus macaque using polymerase chain reaction . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of growth hormone receptor in mouse preimplantation embryos . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
OBJECTIVES : To summarize the steps that led to the recognition of the Laron syndrome of growth hormone ( GH ) insensitivity as a recessive disorder that is caused by mutations in the growth hormone receptor ( GHR ) gene , to discuss the different types of mutations that have been found in the GHR gene , and to examine whether the degree of growth impairment in affected homozygotes depends on the specific type of GHR mutation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Following routine fixation and paraffin embedding , sections were treated with antisera to rat growth hormone , rat growth hormone binding protein and growth hormone receptor . ^^^ Overall , growth hormone and its binding protein were located both in the cellular elements and throughout the extracellular matrix , whereas the growth hormone receptor showed an exclusively intra cellular location . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Human growth hormone receptor : cloning and expression of the full length complementary DNA after site directed inactivation of a cryptic bacterial promoter . ^^^ Growth hormone receptor is a cytokine type receptor which is required for normal somatic growth and for numerous metabolic processes . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The growth hormone receptor gene mutation of a Japanese patient with Laron syndrome . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Differential expression of the growth hormone receptor and its transcript in bovine uterus and placenta . ^^^ By reverse transcription polymerase chain reaction ( RT PCR ) the transcript of the growth hormone receptor ( GHR ) was proved in bovine placentae of different gestational stages . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Linkage of the ubiquitin conjugating system and the endocytic pathway in ligand induced internalization of the growth hormone receptor . ^^^ Recently , ubiquitin conjugation has been implicated in the downregulation of signalling receptors such as the mammalian growth hormone receptor ( GHR ) and the alpha factor receptor in yeast . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Effects of luteotrophic and luteolytic hormones on expression of mRNA encoding insulin like growth factor 1 and growth hormone receptor in the ovine corpus luteum . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The present study was conducted to determine the influence of food restriction on growth hormone receptor ( GHR ) in porcine skeletal muscle ( longissimus dorsi and trapezius ) and liver in relationship to plasma growth hormone binding protein ( GHBP ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Insulin and insulin like growth factor 1 acutely inhibit surface translocation of growth hormone receptors in osteoblasts : a novel mechanism of growth hormone receptor regulation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone concentration in urine was measured by an immunometric assay , and growth hormone receptor gene expression was measured by RNase protection assay or by quantitative reverse transcriptase polymerase chain reaction in total RNA isolated from epidermal suction blister roofs . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The G CSF receptor sequence was aligned with all the available sequences of the gp 130 and growth hormone receptor families and a model of the cytokine receptor homologous domain was constructed , based on the growth hormone receptor structure . ^^^ These residues formed a binding face on the receptor model resembling the growth hormone receptor site , which suggests that the model is reasonable . ^^^ However , electrostatic analysis of the model provided further evidence that the mechanism of receptor dimerization is different from that of the growth hormone receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Activation of the prolactin receptor but not the growth hormone receptor is important for induction of mammary tumors in transgenic mice . ^^^ Since human growth hormone gene can activate both the growth hormone receptor ( GHR ) and the prolactin ( PRL ) receptor ( PRLR ) , it is not clear which receptor system is responsible for the malignant transformation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Hepatic growth hormone receptor , insulin like growth factor 1 , and insulin like growth factor binding protein messenger RNA expression in pediatric liver disease . ^^^ In both groups , growth hormone receptor mRNA expression was examined by quantitative reverse transcription polymerase chain reaction , IGF 1 mRNA expression by ribonuclease protection assay , and IGFBP 1 to 4 mRNA expression by Northern analysis . ^^^ Growth hormone receptor and IGF 1 mRNA levels were reduced 1 . 7 fold ( P = . 003 ) and 9 . 6 fold ( P = . 0001 ) in biliary atresia compared with levels in controls . ^^^ Changes in growth hormone receptor and IGF 1 mRNA expression may account for the reduction in serum IGF 1 found in pediatric liver disease . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A high level of growth hormone receptor ( GHR ) was detected on the hepatic membranes of the snakehead fish ( Ophiocephalus argus Cantor ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Ubiquitination machinery is required for ligand induced endocytosis of the growth hormone receptor , suggesting that ubiquitin dependent endocytosis and sorting is also an important regulatory process in mammalian cells . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor gene expression in the mouse uterus : modulation by gonadal steroids . ^^^ OBJECTIVES : We hypothesized that the mouse uterus expresses a growth hormone receptor ( GHR ) and that mouse endometrial GHR mRNA may undergo in vivo regulation by estradiol ( E 2 ) and progesterone ( P ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Cloning of the GC rich 5 ' noncoded exon and putative promotor of the gene for human growth hormone receptor ] . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The abundance of hepatic cDI 1 transcripts in growth hormone receptor ( GHR ) deficient dwarf chicken was similar to normal chickens despite lower levels of plasma T 3 ( 37 % lower ) and elevated levels of T 4 ( 21 % higher ) in dwarf chickens . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
CONCLUSION : Waist circumference , an indicator of abdominal body fat mass , is a major determinant of GHBP levels during childhood , while leptin may be one candidate for a signal linking adipocytes to the growth hormone receptor related GHBP release . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor ( GH R ) gene expression was evaluated in avian growth plates in situ and in cultured chondrocytes . ^^^ Both the ascorbic acid treated and untreated chondrocytes expressed the gene coding for the chicken growth hormone receptor ( cGH R ) , but only the undifferentiated cells were capable of binding the hormone . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Finally , the regulation of the bacterial aspartate receptor and the human growth hormone receptor is discussed as a function of ligand induced asymmetry . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Signal transduction by the growth hormone receptor ( GHR ) occurs through growth hormone ( GH ) induced dimerization of two GHRs to form a trimeric complex . ^^^ Activation of chimeric and full length growth hormone receptors by growth hormone receptor monoclonal antibodies . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Morphine alters the levels of growth hormone receptor mRNA and [ 125I ] growth hormone binding in human IM 9 lymphoblasts via a naloxone reversible mechanism . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Ontogeny of growth hormone receptor gene expression in tissue of growth selected strains of broiler chickens . ^^^ The purpose of this study was to determine the relationship between genetic selection for growth traits and tissue expression of the chicken growth hormone receptor ( cGHR ) gene . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In a few other cases , e . g . rat and mouse growth hormone receptor , and mouse CD 40 ligand , homology modelling by ourselves and others reveals that the said sequences are part of a loop , in similarity to all RGD sequences found in proteins with established adhesion function and known 3 dimensional structure . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Autoregulation of central and peripheral growth hormone receptor mRNA in domestic fowl . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Blockade of growth hormone receptor shedding by a metalloprotease inhibitor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The growth hormone receptor resistance in uremia and the decreased IGF 1 by acidosis are additional rationale for the use of growth hormone . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Topography of growth hormone receptor expression in the bovine embryo . ^^^ Using in situ hybridization , mRNA encoding the growth hormone receptor ( GHR ) was localized in preimplantation embryos produced by in vitro fertilization ( IVF ) as well as in 30 to 70 day old bovine embryos . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Nor is it known whether LIFR contacts gp 130 in a manner similar to the growth hormone receptor dimer and , if so , through which of its CBDs . ^^^ Analyses of the electrostatic isopotential surfaces of the CBD models suggest that gp 130 and the membrane proximal CBD of LIFR hetero dimerize and bind LIF through contacts similar to those seen in the growth hormone receptor dimer . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The designed G120R mutant of human growth hormone ( hGH ) is an antagonist and can bind only one molecule of the growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We investigated whether growth hormone ( GH ) may influence the development of mouse embryo in vitro using recombinant GH and anti growth hormone receptor ( GHR ) antibody . ^^^ Growth hormone improves mouse embryo development in vitro , and the effect is neutralized by growth hormone receptor antibody . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Receptors linked to granulocyte or platelet production supported complete erythroid development in vitro and in vivo , as did the growth hormone receptor , a nonhematopoietic receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A comment on normal intelligence in growth hormone receptor deficiency . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Binding experiments , which are likely to represent the binding to site 1 only , to intact FDC P 1 cells transfected with rabbit ( rb ) growth hormone receptor ( GHR ) or with human ( h ) GHR , to Nb 2 rat lymphoma cells , or to rabbit mammary gland membranes prolactin receptor ( PRLR ) , revealed only small or no reduction in binding capacity . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Di leucine mediated internalization of ligand by a truncated growth hormone receptor is independent of the ubiquitin conjugation system . ^^^ The growth hormone receptor ( GHR ) is a member of the cytokine receptor family . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Structural and functional epitopes in the growth hormone receptor complex . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Modulations of human growth hormone receptor level on the cell surface ] . ^^^ Using a monoclonal antibody ( GHRP 2 88 ) raised against the extracellular portion of human growth hormone receptor ( hGHR ) , the mechanisms on modulations of cellular levels of hGHR were investigated in human IM 9 cells . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Assignment of the growth hormone receptor gene to band q 17 of the homeologous sheep 16 and cattle 20 chromosomes . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Polymorphism within the 3 ' flanking region of the bovine growth hormone receptor gene . ^^^ Growth hormone receptor ( GHR ) has a major role in the regulation of growth hormone action , and thus , is an obvious candidate gene associated with milk production traits in mammals . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Zinc regulation of insulin like growth factor 1 ( IGF 1 ) , growth hormone receptor ( GHR ) and binding protein ( GHBP ) gene expression in rat cultured hepatocytes . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The present study examines the effects of maternal undernutrition ( 30 % of the ad libitum available diet ; IUGR group ) throughout pregnancy on hepatic insulin like growth factor 1 ( IGF 1 ) , growth hormone receptor ( GHR ) and GH binding protein ( GHBP ) gene expression using solution hybridisation / RNase protection assays ( RPAs ) . ^^^ Consequences of maternal undernutrition for fetal and postnatal hepatic insulin like growth factor 1 , growth hormone receptor and growth hormone binding protein gene regulation in the rat . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor and cytokine receptor family signaling . ^^^ Structure of growth hormone receptor and the class 1 type of cytokine receptors : common structural features ; cytokine receptor isoforms ; oligomerization of receptor components initiates cytokine signalling . ^^^ Role of the Jak kinases in mediating specific functions of growth hormone receptor and cytokine receptors . ^^^ Regulation of growth hormone receptor and cytokine receptor signaling : binding sites , internalization and ubiquitination ; phosphatases and Janus kinase / Stat inhibitors . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Fetal rat lung epithelium has a functional growth hormone receptor coupled to tyrosine kinase activity and insulin like growth factor binding protein 2 production . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Our results imply that the growth hormone receptor is distinctly expressed in the immature mammary gland , suggesting that GH is involved in growth and differentiation of the fetal mammary gland . . ^^^ Expression of growth hormone receptor in the bovine mammary gland during prenatal development . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Developmental changes in the expression of the growth hormone receptor messenger ribonucleic acid and protein in the bovine ovary . ^^^ By reverse transcription polymerase chain reaction , the transcript of the growth hormone receptor ( GHR ) was demonstrated in oocytes , follicular cells , and corpus luteum of the bovine ovary . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor gene expression was also higher in the former groups . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Cloning and expression of pigeon growth hormone receptor cDNA in COS 7 monkey kidney cells . ^^^ Pigeon growth hormone receptor ( pGHR ) cDNA has been cloned , sequenced , characterized and expressed in COS 7 cells . ^^^ A canonical polyadenylation signal was found in the extracellular region , as was observed in chicken growth hormone receptor cDNA . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Tissue specific regulation of growth hormone receptor and growth hormone binding protein gene expression during pregnancy and lactation in the rat . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Alternative processing of growth hormone receptor transcripts . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
RFLPs at the porcine growth hormone receptor ( GHR ) gene : evidence of an insertion / deletion . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The ability of human tonsillar lymphoid cells to express growth hormone receptor ( hGH N R ) was analyzed by flow cytometry . ^^^ Different lymphoid cell populations thus differ markedly in their ability to express the growth hormone receptor , in relation notably to their activation status . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Although gp 130 contains a cytokine binding homology region ( CHR ) analogous to the extracellular growth hormone receptor , the complexes that utilize gp 130 are not simple dimerizations of receptors around a single cytokine but involve receptor interactions with additional sites on the ligand resulting in higher order complexes . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Identification of a novel ubiquitin conjugation motif , required for ligand induced internalization of the growth hormone receptor . ^^^ In addition to its role in selective protein degradation , the conjugation of ubiquitin to proteins has also been implicated in the internalization of plasma membrane proteins , including the alpha factor receptor Ste2p , uracil permease Fur4p , epithelial sodium channel ENaC and the growth hormone receptor ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Bone mineral , histomorphometry , and body composition in adults with growth hormone receptor deficiency . ^^^ To examine the effects of growth hormone resistance on bone mineral and body composition , we studied 11 adults ( mean age 30 years ) with growth hormone receptor deficiency ( GHRD , Laron syndrome ) and 11 age and gender matched controls from Southern Ecuador . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Induction of synthesis specific for females of variants growth hormone receptor mRNA in liver of male rats ] . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Markers within the regulatory region of the growth hormone receptor gene and their association with milk related traits in Holsteins . ^^^ We studied sequence variations in the regulatory region of the bovine growth hormone receptor gene . ^^^ A polymerase chain reaction ( PCR ) based method for detecting AluI , AccI , and StuI restriction fragment length polymorphisms ( RFLPs ) in the 5 ' flanking region of the bovine growth hormone receptor gene was developed and tested for association with milk related traits in Holstein bulls . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Activation of the adult mode of ovine growth hormone receptor gene expression by cortisol during late fetal development . ^^^ The developmental and tissue specific regulation of growth hormone receptor ( GHR ) mRNA expression is complex and involves alternate leader exon usage . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor ( GHR ) mediated activity of ruminant placental lactogens ( PLs ) and ovine ( o ) GH was compared , using cells transfected with full size human ( h ) , rabbit ( rb ) , and oGHRs . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Isolation and characterization of a novel promoter for the bovine growth hormone receptor gene . ^^^ The use of alternative promoters represents an important mechanism for the regulation of growth hormone receptor ( GHR ) gene expression . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Western immunoblotting studies of human biological fluids identified that IGFBP rP 3 was present in normal serum , pregnancy serum , serum from patients with growth hormone receptor deficiency , cerebrospinal fluid , amniotic fluid , peritoneal fluid , and follicular fluid , while IGFBP rP 3 fragments were identified in cerebrospinal fluid , amniotic fluid , and prepubertal and pubertal urine samples . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The overall fold of this structure , like KIR2DL1 , exhibits K type Ig topology with cis proline residues in both domains that define beta strand switching , which sets KIR apart from the C 2 type hematopoietic growth hormone receptor fold . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Natural history of growth hormone receptor deficiency . ^^^ This review discusses the natural history of growth hormone receptor deficiency ( GHRD ) in relation to epidemiology , mortality , growth , certain aspects of body composition , and intellectual development . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone insensitivity syndrome ( GHIS ) of genetic origin is associated with many different mutations of the growth hormone receptor ( GHR ) gene and a recently described genetic defect of the insulin like growth factor 1 ( IGF 1 ) gene . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Truncated growth hormone receptor isoforms . ^^^ Truncated forms of the growth hormone receptor ( GHR ) that lack the majority of the cytoplasmic domain have been identified in a number of human tissues . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
New growth hormone receptor exon 9 mutation causes genetic short stature . ^^^ Dominant inheritance is shown to result from a heterozygous 876 1 G to C transversion of the 3 ' splice acceptor site preceding exon 9 in the growth hormone receptor ( GHR ) gene . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Heterozygous growth hormone receptor ( GHR ) gene defects are not a common cause of idiopathic short stature . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To investigate this further , we studied the distribution and levels of growth hormone receptor ( GHR ) and GH binding protein ( GHBP ) in the mouse mammary gland . ^^^ Differential expression of the growth hormone receptor and growth hormone binding protein in epithelia and stroma of the mouse mammary gland at various physiological stages . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Regulation of human growth hormone receptor gene transcription by triiodothyronine ( T 3 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of growth hormone receptor in human prostatic carcinoma and hyperplasia . ^^^ By reverse transcription polymerase chain reaction the transcript of the growth hormone receptor ( GHR ) was proved in 21 human prostatic carcinomas and 19 benign prostatic hyperplasias . ^^^ Western immunoblotting using the monoclonal antibody mAb 263 revealed that the growth hormone receptor protein is equally expressed in prostatic carcinoma and hyperplasia . ^^^ Our results imply that the growth hormone receptor may facilitate prostatic tumor cell growth . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Using site directed mutagenesis we mutated the extracellular domain of the ovine growth hormone receptor ( oGHR ) to the corresponding amino acids in the rat GHR at two different sites : site A is between Thr 28 and Leu 34 and represents a major immunogenic epitope , while site B is between Ser 121 and Asp 124 and is involved in the interaction of the human GHR with growth hormone ( GH ) . ^^^ Identification of novel sites in the ovine growth hormone receptor involved in binding hormone and conferring species specificity . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Recently , there has been considerable interest in determining the role of the growth hormone receptor ( GHR ) in the central nervous system ( CNS ) . ^^^ We observed growth hormone receptor / binding protein ( GHR / BP ) immunoreactivity to be rapidly upregulated following a severe unilateral HI injury . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have investigated trafficking of two negative regulators of growth hormone receptor ( GHR ) signaling : a human , truncated receptor , GHR 1 279 , and a GH antagonist , B 2036 . ^^^ Studies with a growth hormone antagonist and dual fluorescent confocal microscopy demonstrate that the full length human growth hormone receptor , but not the truncated isoform , is very rapidly internalized independent of Jak 2 Stat5 signaling . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Whereas CHO cells expressing the growth hormone receptor showed marked downregulation of ligand binding after exposure to dexamethasone ( DEX ) or phorbol myristic acid ( PMA ) , PMA had no effect on expression of ObRa or ObRb , and DEX reduced binding to cells expressing ObRb by 15 % . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Paresis of facial and abducens nerves in a patient with growth hormone receptor deficiency treated with insulin like growth factor 1 ' . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Glucose and amino acids interact with hormones to control expression of insulin like growth factor 1 and growth hormone receptor mRNA in cultured pig hepatocytes . ^^^ A primary pig hepatocyte culture system was used to investigate possible direct effects of glucose and individual amino acids on the expression of growth hormone receptor ( GHR ) and insulin like growth factor 1 ( IGF 1 ) mRNA . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Structure and expression of the mouse growth hormone receptor / growth hormone binding protein gene . ^^^ The mouse growth hormone receptor / growth hormone binding protein ( GHR / BP ) gene produces several distinct mRNA forms through alternative splicing , including mRNAs encoding the membrane bound growth hormone receptor ( GHR ) and the soluble growth hormone binding protein ( GHBP ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The baboon : a model for the study of primate growth hormone receptor gene expression during development . ^^^ In subprimates , significant onset of growth hormone receptor ( GHR ) expression occurs only after birth whereas , in the human , GHR mRNA and protein are widely manifest from the first trimester of fetal life . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Defects of the growth hormone receptor and their clinical implications . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Ovarian growth hormone receptor concentration was highest during the early phases of follicular development ( endogenous vitellogenesis : 315 310 fmol g 1 ovary ) and decreased regularly during oocyte and follicular growth ( exogenous vitellogenesis ) to reach a minimal value at oocyte maturation ( 42 fmol g 1 ovary ) . ^^^ Mean hepatic growth hormone receptor concentration did not vary with the reproductive stage for most of the cycle ( 3 . 0 4 . 5 pmol g 1 liver ) except in endogenous vitellogenesis where significantly higher concentrations were observed ( 6 . 7 pmol g 1 liver ) . ^^^ Individual ovarian growth hormone receptor concentrations were correlated with hepatic growth hormone receptor concentrations , indicating that they are regulated in a similar way . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The growth hormone receptor associates with Jak 1 , Jak 2 and Tyk 2 in human liver . ^^^ Studies in cell lines have shown that Jak 2 is the primary tyrosine kinase involved in signal transduction by the growth hormone receptor ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Selective amplification of exons 3 and 8 of the human growth hormone receptor ( hGHR ) gene based on newly identified intron sequences . ^^^ The gene for human growth hormone receptor ( hGHR ) consists of at least 10 exons , and the corresponding protein is encoded in exons 2 10 which span at least 87 kbp of chromosome 5 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of growth hormone receptor 1A messenger ribonucleic acid in liver of dairy cows during lactation and after administration of recombinant bovine somatotropin . ^^^ The mRNA for growth hormone receptor is transcribed from at least three different promoters in cattle . ^^^ The first promoter ( P 1 ) is liver specific and transcribes growth hormone receptor mRNA containing exon 1A ( growth hormone receptor 1A ) . ^^^ The second and third promoters ( P 2 and P 3 ) are active in a variety of tissues and transcribe growth hormone receptor mRNA containing exon 1B and 1C . ^^^ The objective was to characterize P 1 activity by measuring the amount of growth hormone receptor 1A mRNA in liver of dairy cows at different stages of lactation as well as after administration of recombinant bovine somatotropin ( rbST ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor activation is initiated by GH induced homodimerization of receptor molecules . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The granulocyte macrophage colony stimulating factor ( GM CSF ) receptor ( GMR ) is composed of two chains that belong to the superfamily of cytokine receptors typified by the growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Site directed antibodies to the growth hormone receptor could be potentially useful as growth hormone mimics but , in previous attempts , we found that antisera generated using peptides derived from growth hormone receptor sequences failed to recognize the intact protein . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The growth hormone receptor ( GHR ) , a cytokine receptor superfamily member , requires the JAK 2 tyrosine kinase for signaling . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Transcription from the P 2 promoter of the growth hormone receptor gene involves members of the Sp transcription factor family . ^^^ The P 2 promoter of the gene for growth hormone receptor is developmentally regulated and is differentially active in a number of tissues . ^^^ The identification of four binding sites for Sp 1 and Sp 3 within the P 2 promoter of the gene for growth hormone receptor might point to other factors that interact to regulate the activity of this promoter in different tissues during foetal and post natal development . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor deficiency in Ecuador . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Molecular recognition events involved in the activation of the growth hormone receptor by growth hormone . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A novel phenotype for Lardon dwarfism in miniature Bos indicus cattle suggests that the expression of growth hormone receptor 1A in liver is required for normal growth . ^^^ Mutations within the growth hormone receptor ( GHR ) gene that lead to an inactivated or truncated GHR protein cause abnormal growth and small adult size in a variety of species ( Laron dwarfism ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Disproportional skeletal growth and markedly decreased bone mineral content in growth hormone receptor / mice . ^^^ The skeletal growth and adult bone metabolism was studied in mice with an inactivated growth hormone receptor ( GHR ) gene . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Endocytosis and degradation of the growth hormone receptor are proteasome dependent . ^^^ The ubiquitin conjugation system is involved in ligand induced endocytosis of the growth hormone receptor ( GHR ) via a cytosolic 10 amino acid ubiquitin dependent endocytosis motif . ^^^ Herein , we demonstrate that the proteasome is also involved in growth hormone receptor down regulation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Detection and assay of polymorphism in the growth hormone receptor gene locus in a commercial broiler breeder population . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The molecule expressed on the cell surface of the transduced population is a truncated version of human growth hormone receptor ( deltahGHR ) , capable of ligand ( hGH ) binding , but devoid of the domains involved in signal triggering . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These findings were documented using both surface plasmon resonance and gel filtration experiments and show that ovine placental lactogen ( PL ) heterodimerizes the extracellular domains ( ECDs ) of ruminant growth hormone receptor ( GHR ) and prolactin receptor ( PRLR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of growth hormone receptor in the human brain . ^^^ This study was designed to investigate the presence of growth hormone receptor ( GHR ) expression in the human brain tissue , both normal and tumoral , as well as in the human glioblastoma cell line U87MG . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The human growth hormone receptor gene characterisation of the liver specific promoter . ^^^ Several variants ( V 1 V8 ) have been described for the 5 ' untranslated region of human growth hormone receptor cDNA ( Pekhletsky , R . ^^^ Variants of the 5 ' untranslated sequence of human growth hormone receptor mRNA . ^^^ Isolation of a liver specific promoter for human growth hormone receptor gene . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The results obtained with cultured cells were parallel with in situ immunostaining with 5 bromo 2 ' deoxyuridine and proliferating cell nuclear antigen in breast muscle from experimental chicks , and with growth hormone receptor expression . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Identification of Sp 1 as the transcription factor for the alternative promoter P 2 of the bovine growth hormone receptor gene . ^^^ Growth hormone receptor ( GHR ) mRNA variants that differ in the 5 ' untranslated regions ( 5 ' UTR ) have been isolated in various species . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Analysis of the intracellular signalling domain of the human growth hormone receptor in children with idiopathic short stature . ^^^ OBJECTIVE : To investigate the hypothesis that intracellular , dominant negative mutations of the growth hormone receptor ( GHR ) exist in children with idiopathic short stature ( ISS ) and partial growth hormone insensitivity ( GHI ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Species specific alternative splice mimicry at the growth hormone receptor locus revealed by the lineage of retroelements during primate evolution . ^^^ In humans , growth hormone receptor ( GHR ) transcripts exist in two isoforms differing by the retention ( GHRfl ) or exclusion ( GHRd 3 ) of exon 3 , whereas in mice GHRfl is solely expressed . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Treatment of acromegaly with the growth hormone receptor antagonist pegvisomant . ^^^ Pegvisomant is a genetically engineered growth hormone receptor antagonist that blocks the action of growth hormone . ^^^ CONCLUSIONS : On the basis of these preliminary results , treatment of patients who have acromegaly with a growth hormone receptor antagonist results in a reduction in serum IGF 1 concentrations and in clinical improvement . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Recombinant extracellular domain of rabbit growth hormone receptor and biological activity of somatogenic hormones . ^^^ The cDNA of the extracellular domain of rabbit growth hormone receptor ( rbGHR ECD ) was cloned in the prokaryotic expression vector pMON , to enable its expression in Escherichia coli after induction with nalidixic acid . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
For liver , muscle , and kidney , there was no significant difference in the expression of growth hormone receptor mRNA between control and burn rats . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Control of ovine hepatic growth hormone receptor and insulin like growth factor 1 by thyroid hormones in utero . ^^^ By use of RNase protection assays , hepatic growth hormone receptor ( GHR ) and insulin like growth factor 1 ( IGF 1 ) mRNA abundances were measured in sheep fetuses after experimental manipulation of fetal plasma thyroid hormone concentrations by fetal thyroidectomy ( TX ) and exogenous infusion of triiodothyronine ( T ( 3 ) ) and cortisol . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of growth hormone receptor in human liposarcomas and lipomas . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Monoclonal antibody against human growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor abundance in tibial growth plates of uremic rats : GH / IGF 1 treatment . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Knowledge of the interaction between growth hormone ( GH ) and the growth hormone receptor ( GHR ) has led to the rational design of a GHR antagonist . ^^^ Growth hormone receptor antagonists therapy for acromegaly . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Decreased growth in angus steers with a short TG microsatellite allele in the P 1 promoter of the growth hormone receptor gene . ^^^ A polymorphic TG repeat microsatellite is located 90 base pairs upstream from a major transcription start site in the bovine growth hormone receptor gene . ^^^ The purpose of this study was to compare growth and carcass traits between Angus steers that had two of the longer growth hormone receptor alleles with their half siblings that had one short allele and one of the longer alleles . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Rapid communication : Single nucleotide polymorphisms detected in exon 10 of the bovine growth hormone receptor gene . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The gene expression and localization of IGF 1 , its receptor , and the growth hormone receptor ( GHR ) were investigated during ongoing ACE inhibition . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Additionally the expression of fibroblast growth factor receptor ( FGFR ) and growth hormone receptor ( GHR ) was investigated . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The aim of this study was to determine the in situ expression of growth hormone receptor ( GHR ) and prolactin receptor ( PRLR ) in hepatocellular carcinomas and to compare the results with normal liver . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Compensatory alterations of insulin signal transduction in liver of growth hormone receptor knockout mice . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor ( GHR ) dimerization is a prerequisite to the generation of growth hormone ( GH ) action . ^^^ Pegvisomant : a growth hormone receptor antagonist for the treatment of acromegaly . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The ability of ovine placental lactogen ( oPL ) to bind to the growth hormone receptor ( GHR ) raises the possibility that oPL may exert a growth hormone ( GH ) like action on galactopoiesis . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Autoregulation of growth hormone receptor and growth hormone binding protein transcripts in brain and peripheral tissues of the rat . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The cell surface growth hormone receptor , a member of the cytokine receptor superfamily , binds as a dimer to a single growth hormone molecule . ^^^ Specific cytoplasmic domains of the growth hormone receptor mediate Jak 2 activation , metabolic actions of growth hormone , Stat activation , and calcium influx . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Differential expression of renal growth hormone receptor and its binding protein in experimental diabetes mellitus . ^^^ The effect of experimental diabetes on renal expression of the growth hormone receptor gene products , including the receptor itself ( GHR ) and its binding protein ( GHBP ) was examined . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The aim of this study was to investigate the interaction of Stat 5 with key effector proteins Erk 2 and Shc after activation by growth hormone ( GH ) , using Chinese Hamster Ovary ( CHO ) cells stably expressing the wild type rabbit growth hormone receptor ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In previous studies we demonstrated that bovine cumulus oocyte complexes ( COCs ) obtained from small and medium sized follicles express growth hormone receptor ( GHR ) mRNA and respond to growth hormone ( GH ) addition during in vitro maturation . ^^^ Preimplantation bovine embryos express mRNA of growth hormone receptor and respond to growth hormone addition during in vitro development . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Diverse deletions in the growth hormone receptor gene cause growth hormone insensitivity syndrome . ^^^ The syndrome is frequently caused by point mutations in the growth hormone receptor gene ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Furthermore , reverse transcriptase polymerase chain reaction ( RT PCR ) was used to assess the expression of growth hormone receptor ( GHR ) in pre antral follicles . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor gene expression in porcine skeletal and cardiac muscles is selectively regulated by postnatal undernutrition . ^^^ During mild postnatal undernutrition , growth hormone receptor ( GHR ) mRNA abundance decreases in liver but increases in longissimus dorsi muscle . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
DNA cloning and functional expression of growth hormone receptor from soft shelled turtle ( Pelodiscus sinensis japonicus ) . ^^^ The growth hormone receptor ( GHR ) cDNA was cloned from the liver of soft shelled turtle ( Pelodiscus sinensis japonicus ) using the polymerase chain reaction ( PCR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These disorders are controlled by defective alleles at major loci referring to hormones or hormone receptors , e . g . growth hormone receptor for the recessive sex linked dwarfism ( dw ) in chickens and the recessive autosomal Laron type dwarfism in man , and growth hormone releasing hormone receptor for the recessive `` little ' ' mutation ( lit ) in mice . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor ubiquitination coincides with recruitment to clathrin coated membrane domains . ^^^ Endocytosis of the growth hormone receptor ( GHR ) depends on a functional ubiquitin conjugation system . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Finally , growth hormone receptor ( GHR ) antagonists are under development for the use in humans . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Follistatin ( FST ) , growth hormone receptor ( GHR ) and prolactin receptor ( PRLR ) genes map to the same region of sheep chromosome 16 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We investigated the influence of maternal dietary restriction between days 28 and 80 of gestation followed by re feeding to the intake of well fed ewes up to 140 days of gestation ( term is 147 days ) in sheep , on expression of mRNA for insulin like growth factor ( IGF ) 1 , IGF 2 and growth hormone receptor ( GHR ) in fetal liver and skeletal muscle . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The signal transduction of the growth hormone receptor is regulated by the ubiquitin / proteasome system and continues after endocytosis . ^^^ The growth hormone receptor ( GHR ) intracellular domain contains all of the information required for signal transduction as well as for endocytosis . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor antagonists : potential indications ] . ^^^ Pegvisomant is a mutated human growth hormone molecule , which binds to the growth hormone receptor . ^^^ Therefore , in high concentrations pegvisomant acts as a growth hormone receptor antagonist . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In contrast to the extracellular domain of the growth hormone receptor ( GHR ) , the structure of the agonist bound EpoR extracellular region shows only minimal contacts between the membrane proximal regions . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor interaction with Jak proteins differs between tissues . ^^^ The growth hormone receptor ( GHR ) is believed to interact predominantly with Jak 2 , but studies on cell lines have shown that it may also induce phosphorylation of Jak 1 and Jak 3 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Variants of the 5 ' untranslated region of the bovine growth hormone receptor mRNA : isolation , expression and effects on translational efficiency . ^^^ The growth hormone receptor ( GHR ) gene in cattle is expressed as multiple GHR mRNA variants that differ in the 5 ' untranslated region ( 5 ' UTR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Receptors of IL 2 ( beta and gamma ) and PRL belong to the same `` Cytokine Growth Hormone Receptor Superfamily ' ' . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor is expressed in human breast cancer . ^^^ We analyzed 48 human breast carcinomas using reverse transcription polymerase chain reaction , immunohistochemistry , and Western blotting techniques to assess growth hormone receptor expression . ^^^ These analyses revealed that growth hormone receptor ( GHR ) is expressed in human breast cancer and appears to be up regulated compared to adjacent normal breast tissue . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
CMT U 335 cells spontaneously express the growth hormone receptor ( GHR ) as well as the prolactin receptor ( PRLR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Quantification of growth hormone receptor extra and intracellular domain gene expression in chicken liver by quantitative competitive RT PCR . ^^^ The very sensitive competitive reverse transcription polymerase chain reaction ( RT PCR ) was used to investigate the expression of the extracellular ( GHRe ) and intracellular ( GHRi ) parts of the growth hormone receptor ( GHR ) in the liver tissue of chickens . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Exons of growth hormone receptor ( GHR ) and breast cancer susceptibility ( BRCA 1 ) genes were sequenced for a wide diversity of rodents and other mammals and combined with sequences of the mitochondrial 12S rRNA gene and previously published sequences of von Willebrand factor ( vWF ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The present state of knowledge about growth hormone binding proteins ( GHBP ) is reviewed , with particular emphasis on the high affinity GHBP , which represents the circulating ectodomain of the growth hormone receptor ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
During the active stages of dentinogenesis , odontoblasts are growth hormone receptor ( GHr ) positive . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In this study we have characterized the nucleotide sequence of the cDNA for the growth hormone receptor ( GHR ) and examined the effects of morphine on the gene transcripts for GHR as well as GH binding protein ( GHBP ) in the male rat hippocampus and spinal cord . ^^^ Morphine decreases the levels of the gene transcripts of growth hormone receptor and growth hormone binding protein in the male rat hippocampus and spinal cord . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Also , human growth hormone receptor ( GHR ) displays species specificity ; i . e . , it can interact only with human ( or rhesus monkey ) GH , not with nonprimate GHS : The species specificity of human GHR is largely due to the Leu > Arg change at position 43 , and it has been hypothesized that this change must have been preceded by the His > Asp change at position 171 of GH . ^^^ Episodic evolution of growth hormone in primates and emergence of the species specificity of human growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
TNF alpha downregulates murine hepatic growth hormone receptor expression by inhibiting Sp 1 and Sp 3 binding . ^^^ This may be due to growth hormone resistance caused by cytokine induced suppression of growth hormone receptor ( GHR ) gene expression . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor gene variant and mandibular height in the normal Japanese population . ^^^ This study was aimed at quantitatively evaluating the relationship between craniofacial morphology and the Pro561Thr ( P56IT ) variant in the growth hormone receptor gene ( GHR ) , which is considered to be an important factor in craniofacial and skeletal growth . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Fish growth hormone receptor : molecular characterization of two membrane anchored forms . ^^^ A RT PCR approach was used to clone and sequence the full length growth hormone receptor ( GHR ) of a teleost fish , the turbot ( Scophthalmus maximus ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
OBJECTIVE AND METHOD : We studied the effects of human growth hormone ( hGH ) on leptin production and lipolysis stimulation in the presence or absence of human growth hormone binding protein ( hGHBP ) using 3T3 L 1 hGHR adipocytes which efficiently express human growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor ubiquitination , endocytosis , and degradation are independent of signal transduction via Janus kinase 2 . ^^^ The ubiquitin proteasome system is required in growth hormone receptor ( GHR ) endocytosis . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
CONCLUSIONS : These data suggest that decreased levels of maternal growth hormone binding protein , and by implication growth hormone receptor complement , may underlie the early severe growth restriction that is characteristic of trisomy 18 . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Inherited growth hormone insensitivity ( GHI ) is a heterogeneous disorder that is often caused by mutations in the coding exons or flanking intronic sequences of the growth hormone receptor gene ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Signal transduction via the growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The ubiquitin proteasome pathway regulates lysosomal degradation of the growth hormone receptor and its ligand . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A role of these mediators has been implicated in signaling pathways found downstream of growth hormone receptor and receptor tyrosine kinases , including the insulin , insulin like growth factor 1 ( IGF 1 ) , platelet derived growth factor ( PDGF ) , nerve growth factor , hepatocyte growth factor , and fibroblast growth factor receptors . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GT repeat polymorphism in the 5 ' flanking region of the human growth hormone receptor gene . ^^^ A polymorphic GT dinucleotide repeat sequence has been identified in the 5 ' flanking region of the human growth hormone receptor ( hGHR ) gene on chromosome 5p13 . 1 p 12 , within the promoter region of the V 9 5 ' UTR exon . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We used murine Ba / F3 cells transfected with human growth hormone receptor ( hGHR ) cDNA to investigate the regulatory mechanisms of human growth hormone binding protein ( hGH BP ) release . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor antagonists : discovery and potential uses . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In order to examine if Z chromosome inactivation , which is analogous to 10 chromosome inactivation in mammals , takes place in male birds having ZZ sex chromosomes , five Z linked genes of chickens which are expressed in both sexes in certain tissues were selected : i . e . genes for growth hormone receptor , nicotinic acetylcholine receptor beta 3 , aldolase B , beta 1 , 4 galactosyltransferase 1 , and iron responsive element binding protein ( also known as cytosolic aconitase ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
OBJECTIVE : Pegvisomant is a mutated GH molecule which prevents functional dimerization and subsequent activation of the growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Characterization of the growth hormone receptor in human dermal fibroblasts and liver during development . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Alu elements in human growth hormone receptor gene 5 ' untranslated region exons . ^^^ The human growth hormone receptor ( hGHR ) is encoded by exons 2 10 of the hGHR gene on chromosome 5p13 . 1 p 12 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The ubiquitin dependent endocytosis motif is required for efficient incorporation of growth hormone receptor in clathrin coated pits , but not clathrin coated lattices . ^^^ Endocytosis of the growth hormone receptor ( GHR ) requires an active ubiquitin conjugation system . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Effect of a growth hormone receptor antagonist on proliferative diabetic retinopathy . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Long term treatment of acromegaly with pegvisomant , a growth hormone receptor antagonist . ^^^ BACKGROUND : Pegvisomant is a new growth hormone receptor antagonist that improves symptoms and normalises insulin like growth factor 1 ( IGF 1 ) in a high proportion of patients with acromegaly treated for up to 12 weeks . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These markers are , respectively , enhanced green fluorescent protein ( EGFP ) , beta galactosidase , and truncated versions of human nerve growth factor receptor ( Delta NGFR ) and human growth hormone receptor ( Delta GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To illustrate the tools for accessing the human genome sequence , searches were performed for genes encoding three categories of growth related proteins , insulin like growth factor 1 ( IGF 1 ) receptor , IGF binding proteins and growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Finally , IGF 1 treatment partially restored the expression of growth hormone receptor ( GHR ) and the levels of global genomic DNA methylation , which are reduced in human and experimental cirrhosis . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Laron syndrome by loss of functions of growth hormone receptor ] . ^^^ Laron syndrome , characterized by a short stature with raised serum levels of growth hormone but extremely low levels of insulin like growth factor 1 , is caused by genetic defects of growth hormone receptor , including loss of functions of growth hormone receptor and abnormal growth hormone receptor acting in a dominant negative manner . ^^^ This chapter focused on loss of functions of growth hormone receptor causing disruption of growth hormone binding and intracellular signalling . ^^^ Most mutations and deletions have been found in extracellular domains of growth hormone receptor . ^^^ Serum levels of growth hormone binding protein , cleaved from the extracellular portion of the growth hormone receptor , are typically decreased in most patients but are normal or high in some patients . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Truncated growth hormone receptor mutations function as dominant negative inhibitors of the full length receptor and cause genetic short stature ] . ^^^ Truncated growth hormone receptor ( GHR ) mutations that lack the majority of the cytoplasmic domain have been identified in familial short stature and same truncated GHR isoforms generated by alternative splicing in a number of normal human tissues . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A molecular phylogeny of the rodent superfamily Cavioidea was derived using two nuclear sequences ( exon # 10 of the growth hormone receptor gene and intron # 1 of the transthyretin gene ) and one mitochondrial gene ( 12S rRNA ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Real time RT PCR quantification of insulin like growth factor ( IGF ) 1 , IGF 1 receptor , IGF 2 , IGF 2 receptor , insulin receptor , growth hormone receptor , IGF binding proteins 1 , 2 and 3 in the bovine species . ^^^ We designed and developed nine different calibration curves , based on recombinant DNA plasmid standards and established them on a constant real time PCR platform for the following factors : growth hormone receptor ( GHR ) , insulin like growth factor ( IGF ) 1 , IGF 1 receptor ( IGF 1R ) , IGF 2 , IGF 2 receptor ( IGF 2R ) , insulin receptor ( INSR ) , and IGF binding proteins ( IGF BP ) 1 , 2 and 3 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Computational alanine scanning of the 1 : 1 human growth hormone receptor complex . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Previous studies in pygmies from Africa and Papua New Guinea have shown decreased serum levels of growth hormone binding protein ( GHBP ) , the circulating ectodomain of the growth hormone receptor ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Heterozygote state mutations of the growth hormone receptor gene : what is its significance ? ] . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Two models , the human growth hormone : human growth hormone receptor ( hGH : hGHR ) ( 1 : 2 ) and the granulocyte colony stimulating factor : granulocyte colony stimulating factor receptor ( GCSF : GCSFR ) ( 2 : 2 ) complexes , were used for modeling . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of growth hormone receptor and its mRNA in cirrhotic livers ] . ^^^ OBJECTIVE : To investigate the expression of growth hormone receptor in human cirrhotic livers . ^^^ METHODS : Radio ligand binding assay and reverse transcription polymerase chain reaction ( RT PCR ) were used to examine the expression of growth hormone receptor and its mRNA in cirrhotic liver tissues near cancer in 32 cases and cirrhotic liver cells near cancer of 6 patients undergoing radical resection of liver cancers . ^^^ The expression of growth hormone receptor mRNA in human cirrhotic liver tissues was significant lower than that in normal control [ riOD , 30 . 8 % + / 8 . 2 % , n = 32 versus 44 . 93 % + / 6 . 25 % , n = 5 ; P < 0 . 05 ] and decreased further along with the aggregation of cirrhosis ( P < 0 . 05 ) . ^^^ CONCLUSION : The expression of growth hormone receptor in human cirrhotic liver cells is downregulated . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Reduced insulin like growth factor 1 after acute feed restriction in lactating dairy cows is independent of changes in growth hormone receptor 1A mRNA . ^^^ Growth hormone receptor ( GHR ) and insulin like growth factor 1 ( IGF 1 ) mRNA decrease in the liver of dairy cows at parturition . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Control of growth hormone receptor and insulin like growth factor 1 expression by cortisol in ovine fetal skeletal muscle . ^^^ Hence , using RNase protection assays and ovine riboprobes , expression of the IGF 1 and growth hormone receptor ( GHR ) genes was examined in ovine skeletal muscle during late gestation and after experimental manipulation of fetal plasma cortisol levels by fetal adrenalectomy and exogenous cortisol infusion . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Pegvisomant ( Sensus Drug Development Corporation ) is a genetically engineered growth hormone receptor antagonist , which inhibits growth hormone action . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Also , if the emergence of species specificity was a result of the selection for a more efficient GH : GHR interaction , then changing residue 43 of the squirrel monkey growth hormone receptor ( smGHR ) to Arg should increase its binding affinity toward higher primate GH . ^^^ Functional promiscuity of squirrel monkey growth hormone receptor toward both primate and nonprimate growth hormones . ^^^ In contrast , its functional counterpart , the human growth hormone receptor ( hGHR ) , has evolved species specificity so that it responds only to Old World primate GHs . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Inactivating mutations leading to growth retardation in humans have been identified in several pituitary transcription factor genes ( HESX 1 , PITX 2 , LHX 3 , PROP 1 , POU1F1 ) as well as in genes encoding the growth hormone releasing hormone receptor ( GHRH R ) , the G ( s ) protein alpha subunit ( GNAS 1 ) , growth hormone itself ( GH 1 ) , the growth hormone receptor ( GHR ) , and in a single case each , the insulin like growth factor 1 ( IGF 1 ) and the IGF 1 receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The implicated effect of GH in diabetic end stage organ damage may be mediated by growth hormone receptor ( GHR ) or postreceptor events in GH signal transduction . ^^^ Modulation of growth hormone signal transduction in kidneys of streptozotocin induced diabetic animals : effect of a growth hormone receptor antagonist . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In addition , we noted a strong colocalization between pcav 1 and growth hormone receptor binding protein 7 ( Grb 7 ) , within these cytoplasmic vesicles , which was not observed in mock infected cells . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Molecular support for Afrotheria and the polyphyly of Lipotyphla based on analyses of the growth hormone receptor gene . ^^^ Parsimony analyses were completed using data from the nucleotide sequence of the tenth exon of the growth hormone receptor gene ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The recombinant form was found to be pure and monomeric as judged by both SDS PAGE and gel filtration chromatography and its biological activity was proven by its ability to bind to the tyrosine phosphorylated cytosolic fragment of human growth hormone receptor fused to glutathione S transferase . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Altered expression levels of several genes identified in this study have been previously noted in meningiomas ( eg , growth hormone receptor , IGFBP 7 , endothelin receptor A , IGF 2 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Puberty is delayed in male growth hormone receptor gene disrupted mice . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Intronic mutation in the growth hormone receptor gene in a Peruvian girl with Laron syndrome . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
B 2036 has increased affinity in one binding site and lowered affinity in its second binding site , it has been shown that this molecule still enables dimerisation of the growth hormone receptor at the cell surface but does not allow the necessary conformational changes for signalling . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In contrast to the growth hormone receptor , we found that the initial endocytosis of LRP minireceptor does not require a functional ubiquitin proteasome system . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Impact of growth hormone resistance on female reproductive function : new insights from growth hormone receptor knockout mice . ^^^ We examined multiple aspects of reproductive function in growth hormone receptor gene knockout ( GHR KO ) and normal mice to clarify the role of growth hormone in female reproduction . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have described previously the properties of two mutant ovine growth hormone receptor extracellular domain ( oGHR ECD ) proteins which were created by substituting sequences from the rat GHR at two different locations within the framework of the oGHR ECD . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Dimerization , ubiquitylation and endocytosis go together in growth hormone receptor function . ^^^ In this review , we will discuss the complexity and implications of this mechanism for membrane trafficking with emphasis on the growth hormone receptor . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
MATERIALS AND METHODS : CHO 4 cells stably expressing the growth hormone receptor were used . ^^^ CONCLUSIONS : Growth hormone exerts a radioprotective effect in CHO 4 cells stably transfected with the complementary DNA for the rat growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Several mechanisms participate in the down regulation of growth hormone receptor ( GHR ) signalling under ligand exposure . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A novel missense mutation of the growth hormone receptor ( GHR ) gene was identified in a Japanese short boy with GH insensitivity . ^^^ A novel heterozygous T51I mutation of growth hormone receptor is not associated with short stature . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor antagonist improves insulin resistance in acromegaly . ^^^ Five subjects ages 28 55 years who were participating in a clinical study that had been designed to assess the effects of a growth hormone receptor antagonist ( Pegvisomant ) on disease activity in acromegaly were evaluated to determine the role of growth hormone hypersecretion in inducing changes in insulin sensitivity . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The ubiquitin proteasome pathway and the regulation of growth hormone receptor availability . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The growth hormone receptor ( GHR ) is also expressed in normal and tumorous canine mammary tissues and in this concise overview we highlight recent advances in our understanding of the significance of the GH / GHR system for mammary gland ( patho ) biology . ^^^ Morphogenic and tumorigenic potentials of the mammary growth hormone / growth hormone receptor system . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
LXR agonist treatment also altered expression of genes involved in steroid hormone synthesis and growth hormone receptor signaling , emphasizing a potential impact on endocrine function . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The effect of a growth hormone receptor antagonist drug on proliferative diabetic retinopathy . ^^^ OBJECTIVE : This study investigated whether the growth hormone receptor antagonist pegvisomant could produce regression of diabetic retinal neovascularization . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of growth hormone receptor mRNA in hepatocellular carcinoma and matched para cancer cirrhotic liver tissue ] . ^^^ BACKGROUND & OBJECTIVE : The growth hormone receptor mRNA is abundant in normal liver tissue , but its expression was not studied in detail in the tissue of liver cancer or para cancer cirrhotic liver . ^^^ This study was designed to investigate the expression of growth hormone receptor mRNA in hepatocellular carcinoma and para cancer cirrhotic liver tissue . ^^^ METHODS : The expression of growth hormone receptor mRNA was detected in 37 specimens of hepatocellular carcinoma and their para cancer liver tissue by RT PCR . ^^^ RESULTS : The expression rate of growth hormone receptor mRNA in hepatocellular cancerous tissue ( 30 / 37 , 81 % ) was significantly lower than that in cirrhotic liver tissue ( 32 / 32 , 100 % ) ( P < 0 . 05 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Pegvisomant is the only available member of a new class of drugs : the growth hormone receptor antagonists . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Physiology of normal growth hormone receptor function . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Molecular modeling of growth hormone receptor mutations . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The high affinity growth hormone binding protein ( GHBP ) , the soluble ectodomain of the growth hormone receptor ( GHR ) , is an integral part of the growth hormone ( GH ) insulin like growth factor axis . ^^^ The soluble growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Recently growth hormone receptor antagonists have been developed by modification of the GH molecule . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Seabream growth hormone receptor : molecular cloning and functional studies of the full length cDNA , and tissue expression of two alternatively spliced forms . ^^^ A full length clone of the growth hormone receptor ( GHR ) was isolated from a cDNA library constructed from the liver of black seabream ( Acanthopagrus schlegeli ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor ( GH ) expressing carcinoid tumors after recombinant human GH therapy for human immunodeficiency virus related lipodystrophy . ^^^ We describe a patient who had growth hormone receptor expressing carcinoid tumors develop in the distal colon and rectum after he received recombinant human growth hormone therapy for human immunodeficiency virus related lipodystrophy . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Enlargement of interscapular brown adipose tissue in growth hormone antagonist transgenic and in growth hormone receptor gene disrupted dwarf mice . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Dimerization and signal transduction of the growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Molecular dissection of a quantitative trait locus : a phenylalanine to tyrosine substitution in the transmembrane domain of the bovine growth hormone receptor is associated with a major effect on milk yield and composition . ^^^ By using a denser chromosome 20 marker map and by exploiting linkage disequilibrium using two distinct approaches , we provide strong evidence that a chromosome segment including the gene coding for the growth hormone receptor accounts for at least part of the chromosome 20 QTL effect . ^^^ By sequencing individuals with known QTL genotype , we identify an F to Y substitution in the transmembrane domain of the growth hormone receptor gene that is associated with a strong effect on milk yield and composition in the general population . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Phylogenetic analysis of over 4600 aligned nucleotide sequences from two nuclear genes , growth hormone receptor and BRCA 1 , provided congruent phylogenies depicting relationships among the major lineages of rodents . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Nucleotide sequences from mitochondrial ( 12S rRNA ) and nuclear ( growth hormone receptor ) genes were used to investigate phylogenetic relationships among South American hystricognath rodents of the superfamily Octodontoidea , with special emphasis on the family Octodontidae . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Major extension of life span in growth hormone receptor knock out ( GHR KO ) mice that are GH resistant , and subsequently , IGF 1 deficient indicates that similar mechanisms may operate in mammals . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Genetic disruption of the growth hormone receptor does not influence motoneuron survival in the developing mouse . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of growth hormone receptor in hepatocellular carcinoma and its significance ] . ^^^ But there are still many arguments on whether it can be used in hepatocellular carcinoma ( HCC ) patients . rhGH can not work except that it combines to its own receptor growth hormone receptor ( GHR ) . ^^^ METHODS : Radioreceptor assays were used to determine growth hormone receptor ( GHR ) in 40 HCC tissues ; 6 normal liver tissues were used as control . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Association of single nucleotide polymorphisms in the growth hormone and growth hormone receptor genes with blood serum insulin like growth factor 1 concentration and growth traits in Angus cattle . ^^^ This study was conducted to identify polymorphisms in the promoter and coding regions of the bovine growth hormone and growth hormone receptor genes and to study association of polymorphisms identified in these genes with growth traits and serum insulin like growth factor 1 ( IGF 1 ) concentration . ^^^ Polymerase chain reaction based restriction fragment length polymorphism procedures were developed for rapid determination of the single nucleotide polymorphism genotypes in the growth hormone and the growth hormone receptor genes among Angus calves from lines divergently selected for high or low blood serum IGF 1 concentration . ^^^ The single nucleotide polymorphism in the promoter region of the growth hormone receptor gene was associated with serum IGF 1 concentration on d 42 of the postweaning test and with mean IGF 1 concentration . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Relative abundance of growth hormone receptor isoforms in rhesus monkey tissues and human transformed lymphocytes . ^^^ The growth hormone receptor ( GHR ) is expressed as one active , full sequence isoform and one truncated , inactive one that lacks the intracellular signaling domain . ^^^ Growth hormone receptor expression in transformed lymphocytes was also studied by fluorescence activated cell sorter analysis . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of growth hormone receptor and its mRNA in hepatic cirrhosis . ^^^ AIM : To investigate the expression of growth hormone receptor ( GHR ) and mRNA of GHR in cirrhotic livers of rats with the intension to find the basis for application of recombinant human growth hormone ( rhGH ) to patients with liver cirrhosis . ^^^ CONCLUSION : The growth hormone receptor was expressed in a reduced level in liver tissue of cirrhotic rats , and lesser expression of growth hormone receptors was found in a later stage of cirrhosis . ^^^ The reduced expression of growth hormone receptor was partly due to its decreased expression on cirrhotic hepatocytes and the reduced expression of its mRNA in cirrhotic liver tissue . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Although C2C12 myoblasts express low levels of growth hormone receptor ( GHR ) , we failed to see any effect of exogenous growth hormone ( GH ) on cell proliferation or differentiation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
AIM : The present study was aimed to investigate the developmental patterns of growth hormone receptor ( GHr ) and somatostatin ( SS ) mRNA expression in porcine gastric tissue and its relationship with gastric growth and gastric functional development . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Preincubation of irradiated lymphocytes with the growth hormone receptor ( GHR ) antagonists B 2036 and G 120 K abrogated r hGH dependent IL 2 release . 4 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Pegvisomant , a growth hormone receptor antagonist , has recently been evaluated in clinical trials . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
However , in situations where a signaling competent receptor is bound at IL 6 site 1 , ligand binding to site 3 is an absolute requirement for participation of the receptor in a signaling heterodimer with gp 130 ; i . e . , a functional receptor complex of IL 6 type cytokines can not be assembled solely via site 1 and 2 as in the growth hormone receptor complex . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Small glutamine rich tetratricopeptide repeat containing protein ( SGT ) interacts with the ubiquitin dependent endocytosis ( UbE ) motif of the growth hormone receptor . ^^^ Endocytosis of the growth hormone receptor ( GHR ) is regulated by the ubiquitin conjugating system . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of p 53 , bcl 2 and growth hormone receptor in actinic keratosis , hypertrophic type . ^^^ Thus , we analyzed p 53 , bcl 2 and growth hormone receptor ( GHR ) expression in hypertrophic type AK ( HAK ) to determine the relative importance of these protooncogenes in the biological behavior of HAK . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Functional expression of guinea pig growth hormone receptor and its mutants in mammalian cells . ^^^ The cDNA of guinea pig ( Cavia porcellus ) growth hormone receptor ( gpGHR ) was cloned using RT PCR in our laboratory . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Regulation of growth hormone receptor gene expression by growth hormone and pegvisomant in human mesangial cells . ^^^ Therefore , we studied the impact of variable concentrations of 22 kD , 20 kD growth hormone , as well as of the growth hormone receptor antagonist pegvisomant ( B 2036 PEG ) , on both the growth hormone receptor ( GHR / GHBP ) gene expression and growth hormone binding protein ( GHBP ) formation in a human glomerular mesangial cell line . ^^^ CONCLUSION : We present data showing that growth hormone has a direct impact on GHR / GHPB gene transcription and that pegvisomant is a potent growth hormone receptor antagonist in human mesangial cells . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of growth hormone receptor isoform exon 3 excluding and exon 3 retaining messenger RNAs in peripheral lymphocytes from normal and acromegalic subjects . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Reduced serum insulin like growth factor ( IGF ) 1 is associated with reduced liver IGF 1 mRNA and liver growth hormone receptor mRNA in food deprived cattle . ^^^ In this study , we explored the underlying mechanism by determining the effects of food deprivation on the levels of total IGF 1 mRNA and total growth hormone receptor ( GHR ) mRNA , as well as the levels of individual IGF 1 mRNA variants and GHR mRNA variants in the liver of steers . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor variant ( L526I ) modifies plasma HDL cholesterol phenotype in familial hypercholesterolemia : intra familial association study in an eight generation hyperlipidemic kindred . ^^^ Defect of growth hormone receptor ( GHR ) is classically known to cause Laron syndrome , characterized by short stature , specific facial appearance , elevated serum growth hormone levels , and decreased insulin like growth factor 1 levels . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Receptor signaling in the growth hormone ( GH ) growth hormone receptor ( GHR ) system is controlled through a sequential two step hormone induced dimerization of two copies of the extracellular domain ( ECD ) of the receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Subcellular trafficking of growth hormone receptor and Jak 2 under ligand exposure . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Molecular cloning and characterization of gilthead sea bream ( Sparus aurata ) growth hormone receptor ( GHR ) . ^^^ The full length growth hormone receptor ( GHR ) of gilthead sea bream ( Sparus aurata ) was cloned and sequenced by RT PCR and rapid amplification of 5 ' and 3 ' ends . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Analysis of the human growth hormone receptor and IGF 1 coding sequences in children with growth disorders . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Identification of growth hormone receptor in localised neurofibromas of patients with neurofibromatosis type 1 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Computational detection of the binding site hot spot at the remodeled human growth hormone receptor interface . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Pro inflammatory cytokines IL 1 beta and TNF alpha reduce growth hormone receptor mRNA concentration in cultivated rat hepatocytes after stimulation with growth hormone ] . ^^^ Since proinflammatory cytokines mediate many of the acute responses in critical illness , we evaluated the effects of IL 1 beta and TNF alpha on growth hormone receptor ( GHR ) mRNA in cultured rat hepatocytes . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The growth hormone receptor interacts with its sheddase , the tumour necrosis factor alpha converting enzyme ( TACE ) . ^^^ Proteolysis of the GHR ( growth hormone receptor ) occurs at the cell surface and results in the release of its extracellular domain , the GHBP ( growth hormone binding protein ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of genes encoding growth hormone receptor ( GHR ) , type 1 insulin like growth factor receptor ( IGF IR ) , follicle stimulating hormone receptor ( FSHR ) and luteinizing hormone receptor ( LHR ) was measured in granulosa and theca layers of the largest ( F 1 ) , third largest ( F 3 ) , fifth largest ( F 5 ) preovulatory follicles and large white follicles ( LWF ) in the ovary of Shaoxing ducks , with relative quantitative reverse transcription polymerase chain reaction ( RT PCR ) using beta actin as an internal standard . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor ( GHR ) , IGF 1 and SOCS 3 mRNA expression was measured in the liver of rats fed with a low protein diet and with GH stimulation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Identification of two novel mutations in the human growth hormone receptor gene . ^^^ Deletions and mutations in the growth hormone receptor gene are the underlying etiology of Laron syndrome ( LS ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A novel mutation of the growth hormone receptor gene ( GHR ) in a Chinese girl with Laron syndrome . ^^^ This disease is frequently caused by a point mutation in the growth hormone receptor gene ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Diverse regulation of full length and truncated growth hormone receptor expression in 3T3 L 1 adipocytes . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Since some 20 and 22 kDa hGH biological activities are not identical , we decided to map the prolactin ( PRLR ) and growth hormone receptor ( GHR ) binding sites for both isoforms . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Immunoreactivity of the growth hormone receptor is detectable from day 3 after fertilization , and so growth hormone acting in either a paracrine or endocrine manner may serve to regulate glucose , glycogen and lipid metabolism . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Real time RT PCR using SYBR Green 1 detection was employed to determine mRNA expressions of the following factors : ubiquitin ( UBQ ) , insulin like growth factor 1 ( IGF 1 ) , IGF 2 , IGF receptor type 1 ( IGFR 1 ) , growth hormone receptor ( GH R ) and IGF binding proteins 1 6 ( IGFBP 1 6 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Dexamethasone treatment decreased ( P < 0 . 05 ) plasma IGF binding protein ( IGFBP ) 1 on days 7 and 14 , but increased ( P < 0 . 05 ) plasma IGFBP 1 , decreased ( P < 0 . 05 ) plasma IGF 1 and IGFBP 3 , and decreased hepatic mRNA for growth hormone receptor ( GHR ) and IGF 1 on day 42 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The patient was subsequently given pegvisomant , an antagonist of growth hormone receptor , to control symptoms of growth hormone excess . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor and insulin like growth factor 1 immunoreactivity in osteoclast like cells during tooth eruption in the toothless ( osteopetrotic ) rat following treatment with colony stimulating factor 1 . ^^^ Treatment of tl / tl rats with colony stimulating factor 1 ( CSF 1 ) activates bone resorption by osteoclasts , permits tooth eruption , and up regulates the immunoreactivity of bone marrow mononuclear cells to growth hormone receptor ( GHr ) and insulin like growth factor ( IGF ) 1 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Plasma hormones and expression of growth hormone receptor and insulin like growth factor 1 mRNA in hepatic tissue of periparturient dairy cows . ^^^ The actions of growth hormone are mediated by the growth hormone receptor ( GHR ) whose mRNA is present in three alternatively spliced forms ( GHR 1A , 1B , and 1C ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of p 53 , bcl 2 and growth hormone receptor in atrophic type of actinic keratosis . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To test this hypothesis , we compared long bone growth in mice with targeted deletions of Igf 1 vs growth hormone receptor ( Ghr ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Pegvisomant is a pegylated analogue of growth hormone ( GH ) that functions as a growth hormone receptor antagonist . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The growth hormone receptor ( GHR ) is a cell surface receptor that mediates the somatogenic and metabolic effects of the growth hormone ( GH ) . ^^^ Caveolar and lipid raft localization of the growth hormone receptor and its signaling elements : impact on growth hormone signaling . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Lipotyphlan ' ' phylogeny based on the growth hormone receptor gene : a reanalysis . ^^^ Evol . 24 ( 2002 ) 91 101 ] challenged this view and argued that `` While the data [ Growth Hormone Receptor ] were unable to support the orders Lipotyphla , Eulipotyphla , and Tenrecoidea [ = Afrosoricida ] this was most likely due to the polyphyly of these groups and not to problems associated with the gene itself such as saturation or highly divergent sequences em leader `` ( p . 100 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Fine structure , expression and polymorphism of the human growth hormone receptor gene ] . ^^^ The human growth hormone receptor gene ( GHR ) is an example of complex transcription units . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Sequence analysis of the growth hormone receptor gene revealed that all three carried a homozygous missense D152G mutation in exon 6 . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Single nucleotide polymorphisms of growth hormone receptor gene in Chinese Han ethnic population ] . ^^^ OBJECTIVE : To analyze the distribution of single nucleotide polymorphisms ( SNP ) of growth hormone receptor ( GHR ) gene in Chinese Han ethnic population . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Effect of two human growth hormone receptor antagonists on glomerulosclerosis in streptozotocin induced diabetic rats . ^^^ The IC 50 ( Mean+ / SD ) values for the mutants for inhibiting 125I hGH binding to rabbit growth hormone receptor were ( 65+ / 10 ) ng for hGHA 1 , ( 27+ / 5 . 6 ) ng for hGHA 2 , and ( 10+ / 0 . 6 ) ng for wild type hGH , respectively . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Clinical review 166 : Growth hormone receptor antagonists . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Based on our previous identification of a dominant negative mutation in the growth hormone receptor that causes familial short stature , we investigated the potential for using a similar truncated mutant of the prolactin receptor ( PRLR 1 242 ) . ^^^ Like the mutant growth hormone receptor , PRLR 1 242 exerts an exceptionally powerful dominant negative effect . ^^^ In accordance with evidence for heterodimer formation between the two receptors , PRLR 1 242 also blocks signalling by the growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Effects of food deprivation on expression of growth hormone receptor and proximate composition in liver of black seabream Acanthopagrus schlegeli . ^^^ The effects of food deprivation on the hepatic level growth hormone receptor ( GHR ) were investigated in black seabream ( Acanthopagrus schlegeli ) both at the protein level ( by radioreceptor assay ) and at the mRNA level ( by ribonuclease protection assay ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Human oocytes and preimplantation embryos express mRNA for growth hormone receptor . ^^^ Human genetic expression of growth hormone receptor ( GHR ) gene was qualitatively analysed using reverse transcription polymerase chain reaction ( RT PCR ) in cumulus cells , immature germinal vesicle ( GV ) and mature metaphase 2 ( MII ) stage oocytes and preimplantation human embryos . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Dairy cows experience selective reduction of the hepatic growth hormone receptor during the periparturient period . ^^^ This reduction coincides with decreased abundance of GHR1A , the liver specific transcript of the growth hormone receptor ( GHR ) gene , suggesting impaired growth hormone dependent synthesis of IGF 1 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These integration driven discoveries contained meaningful and interesting genes not reported in previous expression profiling studies , such as growth hormone receptor , erythropoietin receptor , tissue factor pathway inhibitor 2 , etc . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Disruption of growth hormone receptor gene causes diminished pancreatic islet size and increased insulin sensitivity in mice . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Chicken ovalbumin upstream promoter transcription factor 2 ( COUP TFII ) and hepatocyte nuclear factor 4gamma ( HNF 4gamma ) and HNF 4alpha regulate the bovine growth hormone receptor 1A promoter through a common DNA element . ^^^ The growth hormone receptor ( GHR ) 1A promoter is responsible for transcription of the liver specific GHR mRNA variant 1A in several mammalian species . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Characterization of structure and expression of the growth hormone receptor gene of the Japanese flounder ( Paralichtys olivaceus ) . ^^^ Growth hormone receptor ( GHR ) cDNA and gene of the Japanese flounder ( Paralicthys olivaceus ) were cloned and their molecular structures were characterized . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A common polymorphism of the growth hormone receptor is associated with increased responsiveness to growth hormone . ^^^ In two cohorts of short children treated with growth hormone , we found that an isoform of the growth hormone receptor gene that lacks exon 3 ( d 3 GHR ) was associated with 1 . 7 to 2 times more growth acceleration induced by growth hormone than the full length isoform ( P < 0 . 0001 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The coactivators , steroid receptor coactivator 1 ( SRC 1 ) and growth hormone receptor interacting protein 1 ( GRIP 1 ) , enhanced , while the nuclear receptor corepressor ( N CoR ) abolished the inhibitory effect of RAR beta and RXR alpha on the promoter activity . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The entire procedure is described in detail using hGHbp , a 25 kDa extracellular soluble domain of the human growth hormone receptor , as a model protein . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We examined the effects of diets based on a low isoflavone or a high isoflavone soy protein isolates in normal , growth hormone receptor knockout and Ames dwarf , and Prop 1 ( df ) mice that are hypoinsulinemic , insulin sensitive , and exceptionally long lived , as well as in growth hormone transgenic mice that are hyperinsulinemic , insulin resistant , dyslipidemic , and short lived . ^^^ Glucose tolerance was also improved by high isoflavone diet in growth hormone receptor knockout mice . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
After treatments , the following parameters were examined , including GH binding capacity ( R ( T ) ) by ( 125 ) 1 hGH binding , growth hormone receptor mRNA ( GHR mRNA ) expression by RT PCR , relative content of collagen ( RCC ) by histomorphomertry , and level of malon dialdehyde ( MDA ) and superoxide dismutase ( SOD ) in liver tissue by thiobarbituric acid reaction and pyrogallic acid self oxidation , respectively . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
AIM : To investigate the growth hormone ( GH ) and growth hormone receptor ( GHR ) expression of and its clinical significance in patients with chronic atrophic gastritis ( CAG ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Salmon growth hormone receptor : molecular cloning , ligand specificity , and response to fasting . ^^^ To better understand the role of growth hormone in regulating fish growth , the cDNA of growth hormone receptor ( GHR ) was cloned from the liver of masu salmon ( Oncorhynchus masou ) and characterized . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor expression in human colorectal cancer . ^^^ The purpose of this study was to determine whether human colorectal cancer ( CRC ) expresses growth hormone receptor ( GHR ) and whether growth hormone plays an important role in the development and progression of human CRC . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The role of growth hormone receptor antagonism in relation to acromegaly . ^^^ Recently , a third form of medical therapy , the growth hormone receptor antagonist , pegvisomant , has been licensed for use in acromegaly . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In addition , a decreased immunohistochemical signal for growth hormone receptor and low insulin like growth factor 1 mRNA in the proliferative zone of uremic GP are supportive of reduced chondrocyte proliferation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Crystallization and preliminary 10 ray diffraction analysis of the unliganded human growth hormone receptor . ^^^ The crystal structure of the extracellular domain of growth hormone receptor complexed to its ligand , growth hormone , has been known since 1992 . ^^^ The human growth hormone receptor ' s extracellular ligand binding domain , encompassing amino acid residues 1 238 , has been expressed in Escherichia coli , purified by anion ion exchange chromatography and crystallized in its unliganded state by the hanging drop vapour diffusion method in 100 mM HEPES pH 7 . 0 containing 27 . 5 % ( w / v ) PEG 5000 monomethyl ether and 200 mM ammonium sulfate as the co precipitants . ^^^ The crystal structure will shed light on the nature of any conformation changes that occur upon ligand binding and will provide information to develop potential low molecular weight agonists / antagonists to treat clinical diseases in which the growth hormone receptor is implicated . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In vivo analysis of growth hormone receptor signaling domains and their associated transcripts . ^^^ The growth hormone receptor ( GHR ) is a critical regulator of postnatal growth and metabolism . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor ( GHR ) mRNA was most abundant in mature hypertrophic cells and undetectable in resting cells ; IGF 1 receptor ( IGF IR ) mRNA was detectable in resting cells but two fold higher in the fraction adjacent to cells possessing high GHR mRNA , while proliferating and resting chondrocytes had elevated IGF 1 mRNA levels when compared to that for hypertrophic chondrocytes . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor , JAK 2 , STAT5a , and STAT5b protein levels were unaltered in CRF . ^^^ Growth hormone induced JAK 2 , growth hormone receptor ( GHR ) , and STAT 5 tyrosine phosphorylation was significantly depressed in CRF as was nuclear translocation of phosphorylated STAT 5 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor ( GHR ) is a cytokine receptor superfamily member that binds growth hormone ( GH ) via its extracellular domain and signals via interaction of its cytoplasmic domain with JAK 2 and other signaling molecules . ^^^ Growth hormone receptor is a target for presenilin dependent gamma secretase cleavage . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) plays a central role in growth and metabolism in cattle by binding to growth hormone receptor ( GHR ) and stimulating production of insulin like growth factor 1 ( IGF 1 ) . ^^^ Trait associated sequence variation in the bovine growth hormone receptor 1A promoter does not affect promoter activity in vitro . ^^^ Growth hormone ( GH ) plays a central role in growth and metabolism in cattle by binding to growth hormone receptor ( GHR ) and stimulating production of insulin like growth factor 1 ( IGF 1 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of growth hormone receptor 1A mRNA is decreased in dairy cows but not in beef cows at parturition . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The aim of this report was to evaluate the expression of insulinlike growth factor 1 ( IGF 1 ) , estrogen receptor alpha , estrogen receptor beta , growth hormone receptor , and thioredoxin in a rat model of hypoplastic , hyperplastic , and normal fetal lungs to improve understanding of lung growth . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These peptides , in conjunction with the likely availability of a growth hormone receptor blocking agent ( pegvisomant ) , will further expand the medical therapy options for patients with acromegaly . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The current experiment was conducted to investigate the effect of zinc sulphate ( ZnSO 4 ) and zinc methionine ( Zn Met ) on growth and their effect on plasma growth hormone ( GH ) concentration , growth hormone receptor ( GHR ) and insulin like growth factor 1 ( IGF 1 ) mRNA expression in mice . 2 . ^^^ Effect of zinc sulphate and zinc methionine on growth , plasma growth hormone concentration , growth hormone receptor and insulin like growth factor 1 gene expression in mice . 1 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A total of 283 SNP were discovered in 31 897 base pairs ( bp ) from 12 genes of the growth hormone ( GH ) , growth hormone receptor ( GHR ) , ghrelin , growth hormone secretagogue receptor ( GHSR ) , insulin like growth factor 1 and 2 ( IGF 1 and 2 ) , insulin like growth factor binding protein 2 ( IGFBP 2 ) , insulin , leptin receptor ( LEPR ) , pituitary specific transcription factor 1 ( PIT 1 ) , somatostatin ( SS ) , thyroid stimulating hormone beta subunit ( TSH beta ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Duplication of growth hormone receptor ( GHR ) in fish genome : gene organization and transcriptional regulation of GHR type 1 and 2 in gilthead sea bream ( Sparus aurata ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Validation of microarray results was obtained by a combination of real time and semi quantitative PCR for selected genes , confirming down regulation of Dentin Matrix Protein 1 ( DMP 1 ) , SLIT 2 , Period 2 ( PER 2 ) , Period 3 ( PER 3 ) , osteoadherin , Glypican 3 , Midkine , activin receptor interacting protein 1 ( AIP 1 ) , osteoadherin and growth hormone receptor ( GHR ) , and up regulation of Adrenomedullin ( ADM ) , Interleukin 11 ( IL 11 ) , Bone sialoprotein ( BSP ) , matrix Gla protein ( MGP ) , endothelial cell growth factor 1 ( ECGF 1 ) , inhibin beta A and orosomucoid 1 ( ORM 1 ) , in diseased pulp . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Considering carefully the different reported biochemical outcomes , the central point is whether gamma knife radiosurgery has advantages compared to conventional radiotherapy or , furthermore , to newer medical therapies , such as long acting somatostatin analogues or growth hormone receptor antagonists . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Molecular cloning techniques using primer designed on Oncorhynchus spp . growth hormone receptor ( GHR ) genes allowed to isolate a highly homologous cDNA fragment from RTH 149 mRNA . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor gene expression in the skeletal muscle of normal and double muscled bovines during foetal development . ^^^ The expression of the growth hormone receptor ( GHR ) gene was investigated in semitendinosus muscle during bovine foetal development in both normal and double muscled Charolais foetuses which differ with respect to muscle development . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Model for growth hormone receptor activation based on subunit rotation within a receptor dimer . ^^^ Growth hormone is believed to activate the growth hormone receptor ( GHR ) by dimerizing two identical receptor subunits , leading to activation of JAK 2 kinase associated with the cytoplasmic domain . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The 5th model , growth hormone receptor knockout ( GHR / ) mice , also demonstrated a significant reduction in age related cataract development , as well as dwarfism . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Interestingly , phylogenetic comparisons between the medaka SLR and growth hormone receptor ( GHR ) , which is also isolated in this study , in relation to GHRs of other fish , suggested that all GHRs reported from nonsalmonid species are , at least phylogenetically , SLRs . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Role of the cytokine induced SH 2 domain containing protein CIS in growth hormone receptor internalization . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor deficiency results in blunted ghrelin feeding response , obesity , and hypolipidemia in mice . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
For this purpose , partial cloning and sequencing of the gene encoding rainbow trout growth hormone receptor ( GHR ) was first accomplished by RT PCR , using degenerate primers based on the sequences of non salmonid fish GHR . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The growth hormone receptor gene is associated with mandibular height in a Chinese population . ^^^ Genetic influences are important in the determination of mandibular morphology , and growth hormone receptor ( GHR ) is believed to have an important influence on the growth of craniofacial bone . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Since the clinical introduction of pegvisomant , a growth hormone receptor antagonist , the role of radiotherapy is restricted . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In addition , our data pointed to hitherto unknown interference of these nuclear receptors with growth hormone receptor gene expression and endoplasmic reticulum stress . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Previous studies have investigated the association of low IGF 1 levels attributable to growth hormone receptor deficiency with intelligence but produced mixed results . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Single nucleotide polymorphisms in exon 10 of the chinchilla growth hormone receptor ( GHR ) gene . ^^^ The aim of this study was to detect SNPs in exon 10 of the chinchilla growth hormone receptor gene ( GHR ) by comparative sequencing . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth without growth hormone receptor : estradiol is a major growth hormone independent regulator of hepatic IGF 1 synthesis . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Abundance of mRNA of growth hormone receptor and insulin like growth factors 1 and 2 in duodenal and colonic biopsies of dogs with chronic enteropathies * . ^^^ Therefore , we examined the mRNA abundance of growth hormone receptor ( GHR ) , insulin like growth factors ( IGF ) 1 and 2 in duodenal and colonic biopsies of dogs with CE such as food responsive diarrhoea ( FRD ) and inflammatory bowel disease ( IBD ) before and after treatment as compared with each other and healthy dogs . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Pegvisomant is a pegylated analog of growth that functions as a growth hormone receptor antagonist . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In this initial study of the molecular characterization of our RRV induced BA mouse model system , we also found potential novel candidates important to BA etiology , such as growth hormone receptor and insulin like growth factor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
TP 53 , Bcl 2 and growth hormone receptor expression in cutaneous squamous cell carcinoma . ^^^ The aim of the study was to determine TP 53 , Bcl 2 and growth hormone receptor ( GHR ) expression in SCC and to investigate relative importance of these proto oncogenes in its biological behavior . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The human growth hormone receptor ( GHR ) mediates the effects of growth hormone ( GH 1 ) , starting a signalling cascade that is involved in the regulation of proliferation , differentiation and apoptosis . ^^^ Polymorphisms in the growth hormone receptor : a case control study in breast cancer . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In optimizing the control of acromegaly new therapeutic strategies are evolving ( growth hormone receptor antagonist pegvisomant , potent dopamine agonists , universal somatostatin receptor ligands , chimeric molecules ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Molecular cloning and characterization of growth hormone receptor and its homologue in the Japanese eel ( Anguilla japonica ) . ^^^ Two cDNAs encoding growth hormone receptor ( GHR ) like genes , eGHR 1 and eGHR 2 , were isolated from Japanese eel ( Anguilla japonica ) liver tissue . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Two protein systems , the extracellular soluble domain of the human growth hormone receptor ( hGHbp ) and the phosphatase domain of PFKFB 1 ( BPase ) , were used for the study on effects of DMSO on protein stability , protein aggregation , and binding of drug compounds . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Characterization of growth hormone receptor messenger ribonucleic acid variants in human adipocytes . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
After growth hormone treatment , expression levels of insulin like growth factors 1 and 2 , and growth hormone receptor were determined in the bone regenerate of the original defects . ^^^ Expression of insulin like growth factor 1 in the bone regenerate was lower in the growth hormone treated dogs , whereas insulin like growth factor 2 and growth hormone receptor expression were not increased . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor overexpression predicts response of rectal cancers to pre operative radiotherapy . ^^^ In this study , we evaluated the possible role of Growth Hormone Receptor ( GHR ) expression pattern in determining rectal cancer radiosensitivity . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Application of several tree reconstruction techniques on sequences of the nuclear growth hormone receptor gene and morphological data for all recognized tenrecid genera supports monophyly of Malagasy tenrecids to the exclusion of the two living African genera . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Pretreatment of the animals with gadolinium chloride blocked the inhibitory effect of LPS on body weight , and on serum concentrations of IGF 1 , IGFBP 3 and nitrites , as well as growth hormone receptor ( GHR ) , IGF 1 and IGFBP 3 gene expression in the liver . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Because most primary hepatic carcinoma could express human growth hormone receptor ( GHR ) , this study was to explore the effects of rhGH on the growth of human Bel 7402 hepatic carcinoma ( with GHR expression ) xenograft in nude mice . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Founder effect of E180splice mutation in growth hormone receptor gene ( GHR ) identified in Brazilian patients with GH insensitivity ] . ^^^ We studied the growth hormone receptor ( GHR ) gene in 6 patients with Laron syndrome ( LS ) from 4 unrelated families . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone insensitivity syndrome ( GHIS ) is usually caused by mutations in the growth hormone receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The accumulation of cortical alveoli in the oocytes was associated with increases in plasma and pituitary FSH , plasma estradiol 17beta , and ovarian steroidogenic acute regulatory protein ( star ) gene expression , whereas ovarian transcripts for growth hormone receptor and somatolactin receptor decreased . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor sequence changes do not play a role in determining height in children with idiopathic short stature . ^^^ Previous reports suggest that heterozygous mutations in the growth hormone receptor gene ( GHR ) may account for about 5 % of children with idiopathic short stature ( ISS ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Among the most promising candidate genes for egg production and egg shell quality are annexin A 1 ( ANXA 1 ) , osteoclast stimulating factor ( OSF ) , thrombospondin 4 ( THBS 4 ) , programmed cell death proteins ( PDCD ) , follistatin ( FST ) , growth hormone receptor ( GHR ) , interferon ( IFN ) alpha and beta . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Identification of zinc finger binding protein 89 ( ZBP 89 ) as a transcriptional activator for a major bovine growth hormone receptor promoter . ^^^ The objective of this study was to identify the transcription factors that regulate the expression of growth hormone receptor ( GHR ) 1A mRNA , a major GHR mRNA variant in the bovine liver . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Significant associations were found between four single SNPs , namely DGAT 1 ( acyloCoA : diacylglycerol acyltransferase ) , LTF ( lactoferrin ) , CSN 3 ( kappa casein ) , and GHR ( growth hormone receptor ) and with fat and protein yield and percentage . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone receptor gene deficiency causes delayed insulin responsiveness in skeletal muscles without affecting compensatory islet cell overgrowth in obese mice . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Previous studies have shown that dermal fibroblast cell lines derived from young adult mice of the long lived Snell dwarf ( dw / dw ) , Ames dwarf ( df / df ) and growth hormone receptor knockout ( GHR KO ) mouse stocks are resistant , in vitro , to the cytotoxic effects of hydrogen peroxide , cadmium , ultraviolet light , paraquat , and heat . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Subcellular shift of the hepatic growth hormone receptor with progression of hepatitis C virus related chronic liver disease . ^^^ AIMS : To evaluate the cytoplasmic and nuclear expression of hepatic growth hormone receptor ( GHR ) in different stages ( S 0 , S 1 , S 3 and S 4 , according to Knodell ' s classification ) of chronic liver disease ( CLD ) and in hepatocellular carcinoma ( HCC ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Effects of fasting on the growth hormone ( GH ) growth hormone receptor ( GHR ) insulin like growth factor 1 ( IGF 1 ) axis were characterized in seawater acclimated tilapia ( Oreochromis mossambicus ) . ^^^ Effects of fasting on growth hormone , growth hormone receptor , and insulin like growth factor 1 axis in seawater acclimated tilapia , Oreochromis mossambicus . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The role of the bovine growth hormone receptor and prolactin receptor genes in milk , fat and protein production in Finnish Ayrshire dairy cattle . ^^^ We herein report new evidence that the QTL effect on chromosome 20 in Finnish Ayrshire can be explained by variation in two distinct genes , growth hormone receptor ( GHR ) and prolactin receptor ( PRLR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Surgery and radiotherapy were the mainstay of acromegaly management before the advent of the effective pharmacological therapies of the modern era : somatostatin analogues and pegvisomant , a growth hormone receptor antagonist . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
OBJECTIVE : To evaluate the ocular dimensions in patients with primary growth hormone receptor insensitivity ( Laron syndrome [ LS ] ) and to study the effect of supplemental insulinlike growth factor 1 ( IGF 1 ) on ocular growth . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
For debate : did the small bodied hominis from flores ( Indonesia ) suffer from a molecular defect in the growth hormone receptor gene ( Laron syndrome ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The aim of the present study was to determine the expression of growth hormone ( GH ) , growth hormone receptor ( GHR ) , insulin like growth factor 1 ( IGF 1 ) , insulin like growth factor 2 ( IGF 2 ) , and bone morphogenetic protein 2 ( BMP 2 ) in distraction induced bone regeneration . ^^^ Expression of osteotropic growth factors and growth hormone receptor in a canine distraction osteogenesis model . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Primary cultured fibroblasts of four patients with idiopathic short stature and severe growth delay , which displayed normal growth hormone receptor expression presented a reduced ability for activation of signal transducer and activator of transcription 3 ( STAT 3 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Lipohypertrophy in acromegaly induced by the new growth hormone receptor antagonist pegvisomant . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
All the identified mutations of the growth hormone receptor are included . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Spatio temporal kinetics of growth hormone receptor signaling in single cells using FRET microscopy . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Here , we compare the relative contribution of a nuclear marker the exon 10 of the growth hormone receptor ( GHR ) gene to the one of the mitochondrial CYB for inferring phylogenetic relationships among the major lineages of arvicoline rodents . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Partial purification of somatotropin receptors from pig liver : they arise from a single somatotropin receptor messenger RNA transcript . ^^^ Northern blot analysis revealed that these proteins arise by posttranslational modification of a single 4 . 2 kilobase somatotropin receptor messenger RNA transcript . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Enzymatic removal of N linked oligosaccharides from native bPL resulted in a 1 . 2 2 . 3 fold increase in binding to the somatotropin receptor , whereas receptor binding was unaffected by enzymatic removal of O linked oligosaccharide . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The structure of bovine somatotropin receptor was examined following covalent coupling of iodinated recombinant bovine growth hormone ( [ 125I ] rbGH ) to bovine liver membrane receptors using ethylene glycol bis ( succinimidyl succinate ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Structures of the somatotropin receptor and prolactin receptor on rat hepatocytes characterized by affinity labelling . ^^^ Thus direct affinity labelling , as well as competition for covalent coupling , suggests that the 300 000 , 220 000 and 130 000 Mr species are components of the somatotropin receptor and that the 65 000 and 50 000 Mr complexes result from hormone binding to the prolactin receptor . ^^^ These observations could suggest that a major component of the somatotropin receptor is a trimeric aggregate in which some subunits are retained in a larger complex by interchain disulphide bonds . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Rapid communication : nucleotide sequence of the promoter and first exon of the somatotropin receptor gene in cattle . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Immunohistochemical and nucleic acid analysis of somatotropin receptor populations in the bovine ovary . ^^^ Ovaries were analyzed for somatotropin receptor protein and mRNA through use of immunohistochemistry , solution hybridization / nuclease protection , Northern blotting , and reverse transcriptase polymerase chain reaction ( RT PCR ) . ^^^ As indicated by immunoperoxidase staining , CL expressed immunoreactive somatotropin receptor ( positive stain ) . ^^^ Ovarian stroma , connective tissue , endothelium , and erythrocytes did not express somatotropin receptor ( negative stain ) . ^^^ Within the CL , somatotropin receptor protein was expressed primarily in large luteal cells whereas small luteal cells were negative . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In liver , treatment did not alter the abundance of mRNA for the somatotropin receptor or the number of free binding sites for somatotropin . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The alignment of its amino acid sequence with those of other members of this family ( human somatotropin receptor / murine IL 3 receptor beta and human IL 2 receptor beta ) has suggested that amino acids included in two SSFY repeats found in each of its hematopoietin receptor domains , contribute to the binding of the ligand . ^^^ We present a computer derived three dimensional model of the IL 6 / IL 6 receptor complex based on the structure of the human somatotropin / human somatotropin receptor complex . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of somatotropin receptor messenger ribonucleic acid in bovine tissues . ^^^ The somatotropin receptor mRNA is controlled by at least two different gene promoters that generate two variants with different exon 1 sequences ( 1A and 1B ) . ^^^ The location of 1A and 1B somatotropin receptor mRNA within cattle tissues and , hence , the tissue specificity of the 1A and 1B promoters are unknown . ^^^ In addition , the cDNA sequence of the 1B somatotropin receptor has not been determined . ^^^ Our objective , therefore , was to sequence a cDNA for the 1B somatotropin receptor and to analyze bovine tissues for expression of 1A and 1B somatotropin receptor mRNA . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Rapid communication : polymorphic ( GT ) n microsatellite in the bovine somatotropin receptor gene promoter . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The mRNAs for somatotropin receptor , IGFs 1 and 2 , IGFBP 2 and pregnancy associated glycoprotein ( a marker of trophoblast tissue ) were analyzed by Northern blotting or ribonuclease protection assay . ^^^ Somatotropin dependent regulation of IGF 1 was only observed in liver , where the greatest somatotropin receptor mRNA concentration was found . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Evaluation of the somatogenic activity of bovine placental lactogen with cell lines transfected with the bovine somatotropin receptor . ^^^ Studies have shown that bovine placental lactogen ( bPL ) has partial somatogenic activity in vivo even though binding results clearly indicate bPL does not cause homodimerization of the bovine somatotropin receptor ( bST R ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In control gilts , somatotropin receptor ( STR ) and IGF 1 mRNA abundance in the endometrium decreased with gestation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
OBJECTIVE : The aim was to investigate the effect of pubertal development on serum levels of growth hormone binding protein ( GHBP ) and IGF 1 , and to study the relationship between GHBP levels and height standard deviation score ( SDS ) , nutritional state and IGF 1 levels . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Multiple serial blood sampling was performed in conscious chronically cannulated guinea pigs and both GHBP and GH variants monitored in the same samples by specific RIAs , unaffected by endogenous activities in this species . hGHBP , delta 3hGHBP , hGH , and 20K met hGH ( 10 40 micrograms ) were all cleared rapidly when injected alone ( t1 / 2 = 11 20 min ) . ^^^ Similar results were obtained for hGH complexed with delta 3hGHBP , and over a range of GH : GHBP ratios from 0 . 3 : 1 to 4 : 1 . ^^^ The results imply that the location , extent , and rate of complex formation between GHBP and GH may be an important determinant of the passage of GH between the intra and extravascular compartments , which could affect the pattern of tissue exposure to GH . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
OBJECTIVE : The objective of this study was to investigate the effect of plasma GH levels on the high affinity growth hormone binding protein ( GHBP ) . ^^^ Levels of growth hormone binding protein ( GHBP ) were measured in plasma samples before therapy and 3 , 6 and 12 months after starting treatment . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We determined serum growth hormone binding protein ( GHBP ) , insulin like growth factor 1 ( IGF 1 ) , and growth hormone ( GH ) levels in patients with cirrhosis and in age matched control subjects , and investigated their relationships . ^^^ GHBP levels in cirrhotic patients correlated positively with IGF 1 levels ( r = . 39 , P less than . 01 ) , and negatively with GH levels ( r = . 33 , P less than . 01 ) . ^^^ These results may indicate that the serum GHBP level reflects the number of hepatic GH receptors , and that the high basal GH level observed in cirrhotic patients is , at least in part , attributable to decreased clearance of GH by these receptors . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GHBP was partially purified from chicken , ovine , and porcine serum using GH affinity chromatography . ^^^ The porcine GHBP had the highest and ovine GHBP the lowest affinity for human GH . ^^^ The chemical nature and variations in serum concentrations of growth hormone binding protein ( GHBP ) from humans , rabbits , and rodents have been reported . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
DESIGN : The levels of GHBP , insulin like growth factor 1 ( IGF 1 ) , and growth hormone ( GH ) were determined and analysed as a function of sex and age . ^^^ OBJECTIVE : The effects of sex and age on serum growth hormone binding protein ( GHBP ) levels during adulthood were investigated . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This study of the human growth hormone binding protein ( GHBP ) was undertaken using several samples of hGH , extractive or recombinant , from different origins . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Samples for each age were aliquoted , combined , and assayed for GH , GH binding protein ( GHBP ) , insulin like growth factor 1 , and testosterone . ^^^ GHBP , expressed as a percentage of the [ 125I ] GH bound , increased yearly in males and females , with no relationship to the secretion of sex hormones . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Human serum high affinity growth hormone binding protein ( GHBP ) , as determined by incubation with 125I GH followed by chromatography on AcA 44 gel minicolumns , is lacking in patients with Laron type dwarfism ( LTD ) . ^^^ We found that the specific binding of 125I GH to high affinity GHBP in normal human serum ( m + / SD ) was 11 . 5 + / 1 . 8 % in 10 children 2 3 years old , 15 . 3 + / 2 . 2 % in 10 children 5 8 years old , and 19 . 3 + / 2 . 9 % in 15 adults 20 40 years old . ^^^ This study ( 1 ) shows that high affinity GHBP is diminished in heterozygotes with LTD ; ( 2 ) confirms that high affinity GHBP and VVP are independently regulated , and ( 3 ) suggests that a part of the VVP may not be related to GH binding to some serum components . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Affinity cross linking technique revealed the presence of three growth hormone binding proteins ( GHBP ) in dealbuminized rat serum . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The in vitro biological effects of serum GH binding protein ( GHBP ) were measured in the mouse 3T3 F442A preadipocyte adipogenesis assay during GH stimulation . ^^^ When the hGH concentration was fixed at 0 . 45 nM , a dose dependent inhibition of GH bioactivity was seen over the range of 0 . 1 11 . 3 nM GHBP , with an ED 50 of 3 nM . ^^^ In a homologous receptor assay , the binding of [ 125I ] hGH to IM 9 lymphocytes was inhibited in a dose dependent manner by increasing concentrations of hGHBP in the physiological range , providing further support for the idea that GHBP can regulate the bioactivity of GH by blocking the binding of free GH to target tissues in vivo . ^^^ Our results suggest that one function of GHBP is to dampen the biological effects of pulsatile GH secretion by reducing free GH during secretory pulses . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Serum growth hormone binding protein ( GHBP ) activity was estimated in healthy neonates ( n = 6 ) , children and adolescents ( n = 97 ) and young adults ( n = 19 ) . ^^^ GHBP activity was measured by incubating 125I hGH ( human growth hormone ) ( approximately 25 , 000 c . p . m . ) with serum ( 100 microliters ) in the presence and in the absence of excess unlabelled hGH , followed by separation of specifically bound 125I hGHBP complexes from free 125I hGH by gel filtration on Ultrogel AcA 44 minicolumns . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Finally , specific changes occur in renal GH binding protein ( GHBP ) mRNA , IGF 1 receptor mRNA , and IGFBP mRNA expression in long term diabetes . ^^^ In conclusion , the knowledge we have today indicates that GH and IGFs , through a complex system consisting of GHBP , IGFs , IGF receptors , and IGFBPs , may be responsible for both early and late renal changes in experimental diabetes . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These patients also underwent arginine infusion and L dopa stimulation tests and had measurements of morning baseline GH binding protein ( GHBP ) , IGF 1 , and IGF binding protein 3 ( IGFBP 3 ) plasma concentrations . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The properties of four independent lines of monoclonal antibodies ( MAbs ) specific to rat GH binding protein ( GHBP ) were examined . ^^^ The interaction of these antibodies with GHBP and their effect on GH binding to GHBP were analysed by conventional competition binding assays and surface plasmon resonance , i . e . with a Biospecific Interaction Analysis ( BIAcore ) instrument . ^^^ The antibodies inhibited the interaction of GH with GHBP in the competition binding assay . ^^^ However , in sequential binding on the BIAcore instrument , they were able to bind GHBP after its interaction with GH , indicating that the inhibition observed in the competition binding assay resulted from steric hindrance rather than direct interference with the GH binding site of GHBP . ^^^ The present findings , therefore , suggest that these antibodies are useful for investigating GHBP and its interaction with GH . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To investigate the pathophysiology of growth retardation in adolescents with anorexia nervosa , we measured basal growth hormone ( GH ) , growth hormone binding protein ( GHBP ) , IGF 1 , and insulin like growth factor binding protein 3 ( IGFBP 3 ) in three groups of patients : ( 1 ) 28 recently hospitalized female adolescents with anorexia nervosa , ( 2 ) 23 of the same patients after partial weight restoration , and ( 3 ) 28 healthy control subjects matched for age , sex , and pubertal stage . ^^^ Serum GHBP levels were low in patients in all five pubertal stages and even in those shown to have adequate GH secretion . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To assess the relative determinants of growth rate , we measured serum levels of insulin like growth factor 1 ( IGF 1 ) , IGF binding protein 3 ( IGFBP 3 ) , and GH binding protein ( GHBP ) as well as IGF 1 erythrocyte receptor specific binding ( SB ) in 14 prepubertal GH deficient children before and during the first year of treatment with 0 . 043 mg / kg . day GH . ^^^ GHBP , as measured by ligand mediated immunofunctional assay , showed no significant change during GH therapy and did not correlate with growth response . ^^^ IGF 1 and IGFBP 3 show progressive increases , whereas the erythrocyte IGF 1 receptor binding capacity decreases by 6 months , and GHBP shows little change during the first year of GH treatment . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We studied the gene expression of the insulin like growth factor ( IGF ) 1 , IGF binding protein ( IGFBP ) 3 and growth hormone ( GH ) receptor ( GHR ) / GH binding protein ( GHBP ) in liver of rats treated neonatally with monosodium glutamate ( MSG ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A weaker relationship was shown between the GHBP activity determined in a functional assay based on charcoal separation and log GH ( r = 0 . 51 , p < 0 . 01 ) . ^^^ While insulin like growth factor 1 ( IGF 1 ) and IGF binding protein 3 ( IGFBP 3 ) were correlated directly to log GH ( r = 0 . 77 and r = 0 . 66 , p < 0 . 001 ) , an inverse and weaker relationship was evident between GHBP measured by RIA and IGF 1 or IGFBP 3 ( r = 0 . 61 and r = 0 . 57 , p < 0 . 01 ) . ^^^ In this report we describe a newly developed radioimmunoassay ( RIA ) for the determination of the high affinity growth hormone binding protein ( GHBP ) in human blood . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Before insulin therapy , serum IGF 1 , IGF 2 , IGF binding protein 3 ( IGFBP 3 ) , and GH binding protein ( GHBP ) levels were significantly decreased , whereas IGFBP 1 and cortisol were significantly increased in diabetic children compared to those in an age , sex , and stage of puberty matched control group . ^^^ However , the observation that an increase in serum IGF 1 was observed earlier than an increase in GHBP and without a significant change in serum GH suggests a direct stimulatory effect of insulin on liver IGF 1 production or reversal by insulin of some postreceptor defect in GH action independent of GHBP . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
By day 30 , caloric deprivation to 40 % lowered serum GH , GHBP , IGF 1 and IGFBP 3 , and liver IGF 1 mRNA . ^^^ Protein deprivation lowered serum GH , IGF 1 and IGFBP 3 , and liver IGF 1 mRNA , while GHBP levels were normal . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Obesity is associated with suppressed growth hormone ( GH ) concentrations but relatively little is known about insulin like growth factors ( IGFs ) and binding proteins for GH and IGFs ( GHBP and IGFBPs ) and the modulatory effect of GH administration . ^^^ In a double blind , crossover design we studied the impact of 5 weeks of placebo or GH administration ( 0 . 03 mg . kg 1 body wt . day 1 ) in nine obese women ( mean + / SEM : age 30 . 4 + / 2 . 4 years ; body mass index 37 . 0 + / 2 . 8 kg / m2 ) on IGF 1 , IGF 2 , IGFBP 1 and 3 and GHBP . ^^^ Serum GHBP ( nmol / l ) levels were elevated substantially compared to non obese controls ( p < 0 . 001 ) and did not change during GH treatment ( 2 . 37 + / 0 . 36 ( placebo ) vs 2 . 21 + / 0 . 25 ( GH ) vs 0 . 80 + / 0 . 19 ( control ) ) . ( ABSTRACT TRUNCATED AT 250 WORDS ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The diagnosis based on height standard deviation score ( SDS ) , basal growth hormone ( GH ) , basal insulin like growth factor 1 ( IGF 1 , IGF 1 response in an IGF generation test and growth hormone binding protein ( GHBP ) measurements . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Patients with idiopathic short stature have decreased serum levels of the GH receptor related GH binding protein ( GHBP ) , and low GHBP levels are associated with complete GH insensitivity ( Laron ) syndrome . ^^^ We hypothesized that patients with idiopathic short stature and low GHBP levels may also have a degree of GH insensitivity . ^^^ RESULTS : The patients with low GHBP levels , in comparison with those with normal GHBP levels , had a lower mean extracted standard deviation score for insulin like growth factor 1 ( 3 . 3 + / 1 . 1 vs 2 . 5 + / 1 . 4 ; p < 0 . 0001 ) but mean 12 hour GH values ( 2 . 8 + / 1 . 1 vs 2 . 3 + / 1 . 1 micrograms / L ; p < 0 . 0001 ) . ^^^ Among prepubertal patients , there was no significant difference between the low and normal GHBP groups in mean pretreatment or first year growth rate ( p = 0 . 74 , 0 . 61 respectively ) with comparable doses of GH . ^^^ CONCLUSIONS : Patients with idiopathic short stature and low GHBP levels , compared with those with normal GHBP levels , had significantly lower standardized levels of insulin like growth factor 1 , and higher mean 12 hour GH levels , which suggest partial GH insensitivity . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The short and long term effects of hGH treatment on growth hormone ( GH ) binding protein ( GHBP ) were examined in 18 prepubertal children , aged 1 . 5 10 y , with isolated idiopathic GH deficiency . ^^^ These findings support the role of GH in the regulation of GHBP / receptor in man . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A ligand mediated immunofunctional assay was used to measure levels of GH binding protein ( GHBP ) in plasma from children on GH treatment . ^^^ The samples were analyzed for GHBP and GH . ^^^ To study changes in GHBP levels after onset of GH treatment , samples were taken at the start and after 10 , 30 , and 90 days of treatment ( short term group ) and at the start and after 1 and 2 yr of treatment ( long term group ) . ^^^ In the group given GH at 1800 h there was a decrease in GHBP levels , with the lowest values occurring after 8 10 h , i . e . between 0200 and 0400 h . ^^^ We have previously reported that there was no correlation between endogenous GH peaks and changes in GHBP levels , but there was a small but significant diurnal variation in GHBP levels ( coefficient of variation of about 10 % ) , with a nadir between 0000 and 0400 h . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have also assessed changes in GH binding activity ( GHBP ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
An effort was made in this report to further characterize the immunologic properties of this antibody and its effect on the interaction between pGH and GH binding protein ( GHBP ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Pretreatment plasma / serum levels of GH , IGF 1 , binding proteins for GH ( GHBP ) and IGF 1 ( IGFBP 3 ) were used as a basis for comparison of the levels found after each regimen . ^^^ MEASUREMENTS : Plasma levels of GHBP by standardized binding assay ; GH , IGF 1 , and IGFBP 3 serum / plasma levels by radioimmunoassay . ^^^ Four hourly levels of GH , GHBP , IGF 1 and IGFBP 3 were not correlated . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To determine whether adult serum GH binding protein ( GHBP ) is regulated by androgen , serum GHBP concentrations were compared between 20 normal and 18 hypogonadal men matched for age and body mass index , and the effect of im testosterone treatment ( 250 mg testosterone enanthate ) on GHBP levels in the 18 hypogonadal men was studied . ^^^ The decrease in GHBP level was significant in both the GH sufficient and GH deficient subjects ( P < 0 . 02 in both instances ) , whereas the increase in IGF 1 level was significant in the GH sufficient group ( 199 + / 22 to 235 + / 29 ng / mL ; P < 0 . 04 ) but not in the GH deficient group ( 53 + / 7 to 55 + / 5 ng / mL ; P > 0 . 8 ) . ^^^ Thus , serum GHBP is normal in hypogonadal men but is reduced by testosterone treatment irrespective of endogenous GH secretory status . ^^^ It was concluded that the effect of testosterone on GHBP is pharmacological and occurs independent of GH mediation . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The levels and characteristics of growth hormone ( GH ) binding protein ( GHBP ) and the distribution of GH in peripheral circulation between the free and the bound fractions were studied in three lines of transgenic mice with various degrees of overexpression of bovine ( b ) GH gene . ^^^ The amount of GH bound to GHBP in transgenic animals vs . normal siblings was increased 1 . 8 , 2 . 5 , and 3 . 9 fold in these three lines . ^^^ Consequently , the levels of GH GHBP complexes in the circulation of PEPCK bGH 1 transgenic mice were increased approximately 10 fold . ^^^ The levels of GHBP were not significantly correlated to serum GH within or between lines , perhaps due to elevation of serum GH in PEPCK bGH mice above the level producing maximal response . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Laboratory tests showed hypoglycemia , markedly elevated plasma hGH , low serum insulin like growth factor 1 ( IGF 1 ) with no rise after exogenous hGH , and low serum growth hormone binding protein ( GHBP ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To investigate the mechanisms responsible for the IGF 1 decline , we determined the effects of dietary zinc ( Zn ) deficiency on body and organ growth , serum IGF 1 , serum GH binding protein ( GHBP ) , liver GH receptors and liver expression of their corresponding gene . ^^^ Zinc depletion specifically reduced body weight gain ( 22 % , P < 0 . 05 ) , serum IGF 1 concentrations ( 52 % , P < 0 . 001 ) , hepatic GH receptors ( 28 % ; P < 0 . 05 ) and serum GHBP levels ( 51 % ; P < 0 . 05 ) , compared with the PF group . ^^^ The caloric restriction of PF animals also decreased body weight gain ( 50 % , P < 0 . 001 ) , serum IGF 1 concentrations ( 21 % , P < 0 . 05 ) , liver GH receptors ( 38 % , P < 0 . 001 ) and serum GHBP levels ( 38 % , P < 0 . 01 ) , when compared with the CTR group . ^^^ Both ZD and PF groups had reduced liver IGF 1 and GH receptor / GHBP mRNA levels in comparison with the CTR group ( P < 0 . 01 ) . ( ABSTRACT TRUNCATED AT 250 WORDS ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Plasma concentrations of growth hormone ( GH ) and GH binding protein ( GHBP ) were measured at hourly intervals in five healthy men and five patients with acromegaly during the fed state and after a 5 day fast . ^^^ GHBP concentrations ( both total and complexed with endogenous GH ) were analyzed by the ligand mediated immunofunctional assay ( LIFA ) . ^^^ However , the GHBP / GH complex concentration was significantly higher in acromegalics than in controls ( 41 . 0 + / 2 . 8 5 18 . 0 + / 2 . 2 pmol / L , respectively ; P < . 05 ) , closely followed diurnal GH rhythm in normals , and was significantly correlated with mean 24 hour GH concentrations ( r = . 86 , P < . 01 ) . ^^^ We conclude that plasma concentrations of GHBP are stable throughout the day and are unchanged either by short term calorie deprivation or by chronic exposure to high levels of endogenous GH . ^^^ In contrast , GHBP / GH complex concentrations are altered both acutely and chronically by ambient GH . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The availability of an RIA which is not susceptible to interference by endogenous GH , will facilitate further studies on hormonal and nutritional regulation of the rat GHBP . ^^^ The assay was applied to studying the effects of IGF 1 infusion ( 240 micrograms / day for 1 week ) and GH injection ( 65 micrograms / 100 g body weight , twice daily for 1 week and 4 weeks ) on the serum concentration of GHBP in 11 week old Lewis dwarf rats . ^^^ A radioimmunoassay ( RIA ) for the rat growth hormone binding protein ( GHBP ) was developed using a synthetic peptide ( corresponding to the hydrophilic carboxyl terminal sequence of mouse GHBP ) as standard and a monoclonal antibody ( MAb 4 . 3 ) reactive with this peptide as the primary antibody . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have developed a ligand immunofunctional assay ( LIFA ) for quantifying the circulating functional GH binding protein ( GHBP ) in the rat . ^^^ This two site solid phase assay uses a capture monoclonal antibody ( 4 . 3 ) specific to the hydrophilic C terminal segment of rat GHBP ( rGHBP ) , saturation of binding with human GH , and a detection system of rabbit antihuman GH polyclonal antibody and peroxidase conjugated antirabbit immunoglobulin G antibody . ^^^ This assay was used to determine the GHBP levels in male and female rats and to investigate the diurnal properties and dynamics of GH and GHBP interaction in 15 min blood sampling over a 6 h period . ^^^ In contrast to the pulsatile secretion of GH , GHBP levels in both sexes remained stable and showed no relationship to secretory pulses of GH . ^^^ However , the GH bursts significantly altered the distribution of the GH GHBP complex in male rats . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
During prolonged GH administration , resistance to the anabolic actions of GH seems to occur , and optimizing the anabolic effects of GH or IGF 1 treatment will require a better understanding of the interactions among GH , GHBP , IGF 1 production , IGFBPs , the GH dose regimen , and other unidentified regulatory factors . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Neither exogenous GH ( 20 ng / mL ) nor prolactin ( 100 ng / mL ) interfered with the measurement of GHBP in serum . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Pituitary growth hormone ( GH ) , prolactin ( PRL ) , placental lactogen ( PL ) , insulin like growth factor 1 ( IGF 1 ) and GH binding protein ( GHBP ) in plasma were determined in 12 women with gestational diabetes mellitus ( GDM ) and in 12 healthy pregnant women during a breakfast meal tolerance test . ^^^ In all women there was an inverse correlation between PL and pituitary GH as well as between PL and GHBP , suggesting that PL inhibits pituitary GH secretion . ^^^ Pituitary growth hormone ( GH ) , prolactin ( PRL ) , placental lactogen ( PL ) , insulin like growth factor 1 ( IGF 1 ) and GH binding protein ( GHBP ) in plasma were determined in 12 women with gestational diabetes mellitus ( GDM ) and in 12 healthy pregnant women during a breakfast meal tolerance test . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The increase in hepatic GHR was accompanied by significant increases in plasma GH binding protein ( GHBP ) and in mean residence time of injected GH . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The first method used for detection of growth hormone binding protein ( GHBP ) in biological fluids was based on the incubation of the sample with radiolabeled GH followed by separation of bound and free GH by gel exclusion chromatography . ^^^ These methods include variants of the original binding / column assay ( e . g . , separation of bound and free GH is obtained by immunoprecipitation , charcoal adsorption , ion exchange chromatography , or HPLC ) , and a ligand mediated immunofunctional assay ( LIFA ) , in which a monoclonal antibody is used to capture the GHBP on a microtiter plate ; all binding sites are saturated with GH and an anti GH antibody is used to detect the amount of GH ( endogenous and exogenous ) bound to the GHBP . ^^^ To permit comparison of results obtained by different methods we have cross validated the LIFA with two different binding assays : ( 1 ) the original long column assay ( column assay ) , and ( 2 ) an assay based on immunoprecipitation ( RIPA ) of the GH / GHBP complex with an anti GHBP antibody . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To investigate the role of growth hormone ( GH ) and its downstream axis in normal growth and growth disorders , we measured serum GH binding protein ( GHBP ) levels in children by ligand mediated immunofunctional assay ( LIFA ) . ^^^ In normal short children and patients with GH deficiency , GHBP was lower than normal , but not significant . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Three Laron Syndrome ( LS ) siblings with a post growth hormone ( GH ) receptor defect for insulin like growth factor 1 ( IGF 1 ) synthesis were found to have serum GH binding protein ( GHBP ) levels normal for age . ^^^ Scatchard analysis of the binding of [ 125I ] human GH ( hGH ) to GHBP in patients ' sera before and during therapy revealed affinity constants Ka = 1 . 55 1 . 80 10 10 ( 9 ) M 1 , similar to that of sera from healthy subjects . ^^^ Serum growth hormone binding protein ( GHBP ) activity is decreased by administration of insulin like growth factor 1 in three Laron syndrome siblings with normal GHBP . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH and GHBP activity and not IGF 1 and its receptor activity express growth velocity reduction during treatment of central precocious puberty by a superactive GNRH analogue . ^^^ The GH binding protein ( GHBP ) activity in the controls was 76 . 2 + / 6 . 2 % relative specific binding , similar to that of the patients before therapy . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Elevation of plasma levels of GH ( primarily bGH ) and insulin like growth factor ( IGF 1 ) in these transgenic mice leads to increases in the number of hepatic GH and prolactin ( PRL ) receptors , in the serum levels of GH binding protein ( GHBP ) , in the percent of GHBP complexed with GH , and in the circulating insulin levels . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To investigate the relationship between plasma growth hormone ( GH ) and plasma GH binding protein ( GHBP ) activity we studied the effects of exogenous and endogenous GH on GHBP in children with a normal response to GH stimulation . ^^^ The effect of endogenous GH secretion on GHBP was studied by measuring the integrated concentration ( IC ) of GH and GHBP over 24 h by means of a continuous blood withdrawal procedure . ^^^ We also measured the GH and GHBP response to GH provocative tests . ^^^ During a provocative test there is an abrupt increase in GH but not change in GHBP . ( ABSTRACT TRUNCATED AT 250 WORDS ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The high affinity GH binding protein ( GHBP ) reportedly has an important role in enhancing the growth promoting action of GH . ^^^ It has been hypothesized that each individual adjusts GH production to a level appropriate for his GHBP environment . ^^^ This study was performed to determine the effect of treatment of CPP with the LHRHa leuprolide acetate for depot suspension on GH secretion and levels of GHBP . ^^^ Although GV and GH levels decreased substantially , mean GHBP levels remained unchanged at 139 . 9 + / 46 . 0 and 152 + / 39 . 8 pmol / L . ^^^ In children with CPP , within 6 months of LHRHa therapy , the decrease in GV occurs via a decrease in nocturnal GH secretion as levels of GHBP remain unchanged . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Current methods for measuring GH binding protein ( GHBP ) are laborious , require separation of GHBP complex , and may be affected by endogenous GH content of the sample . ^^^ GHBP levels were not different between normal , acromegalic , or GH deficient subjects . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Continuous i . v . infusion of recombinant human ( h ) GH ( 0 , 3 , 12 , and 48 micrograms / day ) in both dwarf and normal male rats caused a dose dependent decrease in P4502C11 and an increase in P4502C12 , so that the 2C11 / 2C12 ratio fell from 17 . 9 + / 1 . 3 to 1 . 5 + / 1 . 0 in normal males and from 6 . 5 + / 0 . 9 to 0 . 4 + / 0 . 3 in dwarf males ( 0 vs . 48 micrograms hGH / day ) ; over this dose range of hGH , body weight gain , total hepatic insulin like growth factor 1 mRNA levels , and plasma GHBP levels were largely unaffected . ^^^ To test whether baseline GH levels could be modified by circulating GH binding protein ( GHBP ) , hGH infusions were given with and without recombinant hGHBP in different patterns . ^^^ This suggested that intermittent complex formation with GHBP did not prevent continuous access of hGH to the hepatic GH receptors . ^^^ Thus , 2C11 / 2C12 expression is very sensitive to basal GH levels in dwarf rats , and GHBP can alter hepatic gene expression by modifying the pattern of GH exposure . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The recent demonstration of two independent receptor binding sites ( sites 1 and 2 ) on human GH ( hGH ) raises the question of the stoichiometry of circulating GH binding protein ( GH BP ) complexes in human plasma ( i . e . is it one hGH per one GHBP or one hGH per two GHBPs ? ) . ^^^ A functional consequence of the large concentration difference between GHBP in plasma and GH receptors at the cell surface is that the circulating GHBP can serve as a dynamic buffer , modulating bound and free GH and prolonging its half life , whereas the receptor acts as a dominant force in unidirectional capture of GH . ( ABSTRACT TRUNCATED AT 400 WORDS ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These results , taken together with the hypothesis that serum GHBP reflects the number of GH receptors in tissue , suggest that GH receptors are increased in patients with OPLL . . ^^^ Serum growth hormone binding protein ( GHBP ) was measured in 26 patients with ossification of the posterior longitudinal ligament of the spine ( OPLL ) and 19 age matched controls . ^^^ Serum GHBP level was significantly higher in the OPLL group than in the controls , whereas there was no statistical difference between the two groups in serum level of growth hormone , insulin like growth factor ( IGF ) 1 , and IGF 2 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
MEASUREMENTS : Mean 24 hour GH ( from hourly sampling ) , IGF 1 , GH binding protein ( GHBP ) , pituitary ( LH , FSH ) and hepatic function ( SHBG and angiotensinogen ) were measured . ^^^ RESULTS : All three oestrogen formulations resulted in a significant reduction in IGF 1 levels compared to baseline and significant elevations of GH and GHBP ( P < 0 . 05 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
OBJECTIVE : Since there appears to be a relationship between circulating oestrogens and growth hormone , we have investigated the effect of the oestrogen status of adult women on serum levels of GHBP and IGF 1 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GHBP , expressed as a percentage of ( 125I ) GH bound , was determined in 33 patients with Type 1 diabetes ( M / F = 19 / 14 , 12 . 3 + / 0 . 4 years ) before ( day 0 ) , after 5 days ( day 5 ) and after 3 months ( month 3 ) of insulin therapy . ^^^ This study was undertaken ( 1 ) to evaluate growth hormone binding protein ( GHBP ) levels in newly diagnosed patients with Type 1 diabetes before and after insulin therapy and ( 2 ) to determine the relationship of GHBP to glycaemic control , C peptide level and blood pH . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To investigate this concept , we assessed longitudinally another important component of the endogenous GH axis , the serum GH binding protein ( GHBP ) / receptor system , in a cohort of 11 normal boys as they matured through normal puberty . ^^^ At 4 month intervals over 4 . 0 5 . 1 yr , 24 h serum GH concentration profiles and serum GHBP activity were evaluated . ^^^ The overall mean serum GHBP level correlated directly with the overall mean body mass index ( r = 0 . 69 ; P = 0 . 018 ) , but correlated inversely with the mean 24 h GH concentration ( r = 0 . 61 ; P < 0 . 05 ) . ^^^ These data indicate that serum GHBP levels are regulated in individual children within much more narrow limits than those present in the larger population and do not undergo the dramatic changes during puberty typical of GH secretion and linear growth velocity . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Since elevation in growth hormone ( GH ) receptors was reported to be associated with an increase in GH binding protein ( GHBP ) , we suspect that both the increase in the mean residence time and the reduction in specific uptake of GH in the livers of transgenic mice may be the result of an increase in GHBP levels . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Our data agree with the hypothesis that the pubertal spurt is mediated by a sex steroid induced rise in GH concentration , and they suggest that the levels of GHBP may be related to the GH secretion and its variation with treatment . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
OBJECTIVE : Studies in rodents have shown GH binding protein ( GHBP ) levels to be dependent on the mode of GH administration . ^^^ The aim is to determine whether GHBP levels in man are also modulated by the pattern of GH administration . ^^^ In a second study , six normal men received a single subcutaneous injection of 0 . 2 U / kg GH and GHBP activity was measured over 24 hours . ^^^ MEASUREMENTS : GHBP activity was measured by immunoprecipitation using a monoclonal antibody that recognizes the human GHBP , and expressed as percentage specific binding of 125I GH in 50 microliters of serum . ^^^ RESULTS : GHBP activity was not significantly different between the GH deficient and normal subjects . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We report a familial syndrome of short stature associated with partial GH resistance and very high levels of GH binding protein ( GHBP ) . ^^^ The cause and the exact consequences of the very high level of plasma GHBP , resulting in a low proportion of free circulating GH , remain to be clarified . ^^^ The short stature and the partial GH resistance are probably related to high GHBP levels . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Serum GH binding protein ( GHBP ) was evaluated in 2 randomly divided groups of prepubertal children presenting with idiopathic GH deficiency and receiving recombinant human GH , either continuously by sc infusion ( group 1 ) or as 1 daily sc injection ( group 2 ) . ^^^ There was no significant difference in clinical data , GH values , or GHBP levels between the 2 groups before treatment . ^^^ These data show that GH can increase GHBP levels and that there is a differential effect depending on the mode of GH administration , although the reason for and the role of such regulation remains to be explained . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The recent development of an immunofunctional assay for GH binding protein ( GHBP ) facilitates measurement of GHBP in biological fluids . ^^^ Previous methods employed GH binding followed by size exclusion chromatography to determine GHBP levels ( GH binding assay ) , and a considerable body of information exists based on data obtained with that type of assay . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Serum levels of growth hormone ( GH ) and high affinity growth hormone binding protein ( GHBP ) , insulin like growth factor 1 ( IGF 1 ) and IGF binding proteins ( IGFBP ) 1 , 2 and 3 were determined in patients with liver cirrhosis . ^^^ A continuous decline in the concentrations of IGF 1 , IGFBP 3 and serum GH binding activity ( GHBP ) was observed during progression of cirrhosis and the data correlated significantly with choline esterase , total serum protein and the Child score . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The t1 / 2 of free plasma GH , and the concentration and the in vivo dissociation constant ( Kd ) of GH binding protein ( GHBP ) were estimated by dynamic modeling of the postinfusion total plasma GH concentration decay curves . ^^^ Modeling and direct measurements of the off rate of GH from its high affinity GHBP indicated normal dissociation rate constants but decreased molar concentrations of the GHBP in uremic plasma . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH binding protein ( GHBP ) concentrations did not change significantly during the various treatment periods . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) binding protein ( GHBP ) and GH secretion are potential mediators of linear growth in children . ^^^ To study the relationship between these variables , we measured GHBP activity , peak stimulated GH ( PKGH ) , and 24 hour integrated GH concentration ( ICGH ) in 76 children referred for evaluation of growth . ^^^ In 19 children of normal stature ( HGTSD > 2 ) , GRSD increased with GH concentration ( measured both as PKGH and ICGH : P < . 013 , R 2 = . 56 ) but decreased with higher levels of GHBP ( P < . 005 , R 2 = . 62 ) . ^^^ In contrast , for 57 subjects with severe short stature ( HGTSD < or = 2 ) , GRSD could not be predicted from GHBP , GH secretion , HGTSD , or interaction involving these variables . ^^^ These data suggest the hypothesis that under normal conditions , GHBP and GH level may be important predictors of growth rate in children . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
For some responses ( serum IGF 1 and GHBP ) , the obese rats were GH resistant . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The purpose of this study was to characterize circulating growth hormone binding proteins ( GHBP ) and prolactin binding proteins ( PRLBP ) in cattle blood plasma . ^^^ Finally , GHBP concentrations in cattle blood plasma apparently show fluctuations over a 24 hr period , but no correlation was found between these fluctuations and plasma growth hormone concentrations . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
During the placebo control period , serum IGF 1 , LBM , and TBW increased ( P < 0 . 001 ) , whereas BF decreased ( P < 0 . 001 ) and serum GHBP was unchanged in the group treated with GH compared with the patients treated with placebo . ^^^ The best response to GH was obtained in younger patients with low GHBP levels . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
At our clinic we follow the development of MSA of specific binding proteins ( BP ) , trying to introduce or modify the described techniques f . e . the analyses of BP of GH ( GHBP ) , BP for IGF 1 ( IGFBP 3 , IGFBP 1 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We evaluated height velocity , bone age , urinary GH , serum IGF 1 and IGFBP 3 levels throughout the study ; plasma GHBP levels were determined only in the first 12 months of Gn RHa treatment . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
IGF 1 and GH binding protein ( GHBP ) were also measured in subsets of the two age groups . ^^^ CONCLUSIONS : IGF 1 decreases with age in women without identifiable changes in the amount or pattern of GH secretion or in circulating GHBP concentrations . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
All levels of the growth hormone ( GH ) , GH binding protein ( GHBP ) , insulin like growth factor ( IGF ) and IGF binding protein ( IGFBP ) axis are influenced by chronic hypercortisolism . ^^^ Thus , there is a blunted response to GHRH alone or together with other stimuli associated with a marked suppression of endogenous GH secretion but accompanied by normal GHBP , normal to low IGF 1 and GHBPs 1 and 3 with the correspondent 41 . 5 and 38 . 5 kD molecular forms of the latter presenting values similar to normal . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The high affinity growth hormone binding protein ( GHBP ) circulates in human blood and represents the extracellular domain of the growth hormone ( GH ) receptor . ^^^ The effects of GH deficiency on GHBP in adults are not clear . ^^^ The aim of this study was to evaluate serum GHBP levels in adults with GH deficiency and to assess whether GHBP measurement may contribute to the diagnosis of adult GH deficiency , based on a two step model . ^^^ We measured insulin like growth factor 1 ( IGF 1 ) , IGF binding protein 3 ( IGFBP 3 ) and GHBP levels in serum samples of 36 patients with adult onset GH deficiency . ^^^ We conclude that adults with acquired GH deficiency have elevated GHBP levels in comparison to healthy subjects . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Remarkable differences in the somatotropic axis were also observed ; although 24 h GH pulse frequency and levels of IGF 1 and IGFBP 3 were unaltered by either PCOS or obesity , the 24 h mean GH pulse amplitude was increased by 30 % ( P < 0 . 01 ) in lean PCOS in the presence of normal levels of high affinity GHBP and normal GH response to GHRH . ^^^ In addition , GHBP levels were elevated 2 fold and were correlated inversely with GH ( r = 0 . 81 ) and positively with insulin ( r = 0 . 75 ) concentrations . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To address the role of the GH binding protein ( GHBP ) in GH physiology , two forms of recombinant human GHBP ( rhGHBP ) were given alone or in combination with rhGH to hypophysectomized rats or GH deficient dwarf rats . ^^^ It is proposed that by slowing the clearance of GH , GHBP increased the bioactivity of GH . ^^^ This suggests that endogenous circulating GHBP may increase the activity of blood borne GH in a similar manner . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH measurement in serum may be accompanied by IGF 1 and IGFBP 3 measurements , and in some patients by GHBP measurement . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We present a sensitive time resolved fluorometric immunofunctional assay ( TR FIA ) for direct quantitation of functional growth hormone binding protein ( GHBP ) , using an immunoassay kit for growth hormone ( GH DELFIA ) . ^^^ In addition to the immobilized GH antibody , one monoclonal antibody against GHBP was used . ^^^ This assay also allowed detection of GH complexed GHBP in serum . ^^^ These results were in agreement with theoretical values calculated from the measured GH and the functional GHBP concentrations . ^^^ In growth hormone deficient sera GHBP was higher than in control subjects ( 1 . 751 + / 0 . 179 nmol L 1 and 1 . 257 + / 0 . 140 nmol L 1 respectively , P < 0 . 001 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The normal values of insulin like growth factor 1 ( IGF 1 ) , IGF binding proteins 1 and 3 ( IGFBP 1 and IGFBP 3 ) , and the high affinity growth hormone binding protein ( GHBP ) are not well established in large series of healthy fullterm newborns . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH , GH binding protein ( GHBP ) , IGF 1 , and IGF binding proteins 1 5 ( IGFBP 1 through 5 ) ] in adolescent females ( age range , 15 17 yr ) . ^^^ The cross sectional analysis revealed significant ( P < 0 . 05 ) positive correlations between fitness and 1 ) mean 12 h overnight GH levels , 2 ) GHBP , and 3 ) IGF 1 . ^^^ In summary , fitter adolescent girls tended to have increased mean serum GH , GHBP , and IGF 1 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In a basal condition , the GH level was significantly higher in the two malnourished groups than in controls ( p < 0 . 01 ) ; in contrast , the second fraction of GHBP was lower and seemed to be related to the high GH and to a reduction in GH receptors . ^^^ After refeeding , the GH level increased and the second fraction of GHBP decreased . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This study was directed to simultaneously characterize nutritional intake , insulin sensitivity ( by rapid 4 glucose tolerance test ) , and 24 h dynamics of insulin / glucose , cortisol , somatotropic [ GH / GH binding protein ( GHBP ) / insulin like growth factor 1 ( IGF 1 ) / IGF binding proteins ( IGFBPs ) ] , and LH axes in highly trained athletes with ( cycling athletes ; CA ) and without ( amenorrheic athletes ; AA ) menstrual cyclicity and in age and body mass index matched cycling sedentary controls ( CS ; n = 8 / group ) . ^^^ The distorted pattern of GH pulses seen in AA was associated with a 35 % decrease in GHBP levels , not seen in CA . ^^^ In sum , although neuroendocrine metabolic adaptations to the energy cost of exercise training were evident in both groups of athletes , AA displayed alterations distinct from their cycling counterparts , with evidence of a hypometabolic state , including decreased basal body temperature and reduced levels of plasma glucose and serum GHBP , a decrease in the ratio of IGF I / IGFBP 1 , accelerated GH pulse frequency , and elevated interpulse GH levels . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We measured GH levels in blood samples obtained every 20 minutes from 8 : 00 PM to 8 : 00 AM ; AM serum levels of IGF 1 , IGF binding protein 3 ( IGFBP 3 ) , and GH binding protein ( GHBP ) ; muscle strength ; muscle histology ; the normalized phosphocreatine abundance , PCr / [ PCr + Pi ] , and intracellular pH in forearm muscle by NMRS during both sustained and ramped exercise ; body composition by dual energy 10 ray absorptiometry ( DEXA ) ; lipid levels ; and glucose , insulin , and GH levels during an oral glucose tolerance test ( OGTT ) . ^^^ GHRH treatment increased mean nocturnal GH release ( P < . 02 ) , the area under the GH peak ( [ AUPGH ] P < . 006 ) , and GH peak amplitude ( P < . 05 ) , with no change in GH pulse frequency or in levels of IGF 1 , IGFBP 3 , or GHBP Two of six measures of muscle strength , upright row ( P < . 02 ) and shoulder press ( P < . 04 ) , and a test of muscle endurance , abdominal crunch ( P < . 03 ) , improved . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To rule out the possibility of inferences with other endocrine parameters known to be changed in depression or suspected to be related to leptin , we also studied cortisol , insulin , growth hormone ( GH ) and GH binding protein ( GHBP ) . ^^^ Also , GH and GHBP were not related to leptin when controlled for BMI in an ANCOVA model . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
METHODS : The levels of GHBP , complexed GHBP , growth hormone ( GH ) and insulin like growth factor 1 ( IGF 1 ) were determined in fasting serum samples . ^^^ In fasting blood samples GH complexed GHBP ranged from 13 . 8 + / 2 . 4 % ( 9 months ) to 25 . 4 + / 4 . 5 % ( baseline ) of total GHBP . ^^^ Finally , in addition to the lowering effect on GH levels , the induced increase in GHBP levels may imply a further advantage in octreotide treatment of acromegaly . circulating GH bound to GHBP may less readily reach the tissues . . ^^^ OBJECTIVE : In the medical treatment of acromegaly different factors are influential ; among these the impact on growth hormone binding protein ( GHBP ) has not been clarified . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The mutant GH fails to stimulate GH signal transduction by itself , despite possessing a higher affinity than the wild type molecule for GHBP , and appears to have a dominant antagonistic effect on the protein phosphorylation activity of wild type GH . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Distribution analysis of 125I labelled GH in whole plasma suggests that the hormone is bound to two different proteins : first , to the high affinity GH binding protein ( GHBP ) and , second , to the low affinity GHBP , identified as transformed alpha 2 macroglobulin . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To our knowledge no studies have been performed with regard to the relationship between plasma high affinity GH binding protein ( GHBP ) levels and fat distribution in humans . ^^^ To address this question , we measured plasma GHBP and insulin like growth factor 1 levels as well as visceral , sc abdominal , and hip adipose tissue ( AT ) areas by using magnetic resonance imaging scanning in 12 patients with GH deficiency ( GHD ) and in 12 age and sex matched healthy subjects . ^^^ Regardless of the GH status of the subjects , body mass index and visceral AT area were positively correlated to plasma GHBP ( r = 0 . 70 ; P < 0 . 01 and r = 0 . 73 ; P < 0 . 01 , respectively ) , whereas the sc AT areas at the abdominal level tended to correlate positively with GHBP levels , but did not reach significance ( r = 0 . 44 ; P = 0 . 07 ) . ^^^ In the GHD patients the pretreatment visceral and abdominal sc AT areas were positively correlated with the change in GHBP levels after GH replacement ( r = 0 . 82 ; P < 0 . 01 and r = 0 . 75 ; P < 0 . 01 , respectively ) . ^^^ Further , the amount of abdominal fat in GHD patients may partially determine the plasma GHBP response to GH replacement therapy . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This study was undertaken to characterize the serum levels of GH binding protein ( GHBP ) before and during GH treatment in prepubertal short children born small for gestational age ( SGA ) and their relationship with growth parameters . ^^^ The baseline GHBP values ranged from 49 392 pmol / L , and no relationships were found among sex , chronological age , and maximal GH response to an arginine insulin tolerance test . ^^^ No relationship was found between GHBP and spontaneous 24 h GH secretion , in terms of either GH secretion rate or pulsatile pattern , whereas GHBP was positively correlated with insulin like growth factor 1 ( IGF 1 ) SD score ( r = 0 . 28 ; P < 0 . 05 ) and IGF binding protein 3 SD score ( r = 0 . 39 ; P < 0 . 01 ) . ^^^ Using a multiple stepwise linear regression analysis , the model using the IGF binding protein 3 SD score and the weight for height SD score at the start of GH therapy accounted for 33 % of the variance in the baseline GHBP values . ^^^ However , a high degree of variability in the response of individuals to GH treatment in terms of GHBP levels was observed : in some children GHBP levels increased , whereas in others they decreased . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
This mannose rich 34 kDa protein specifically bound human growth hormone ( hGH ) with the same affinity ( kDa = 0 . 42 10 10 ( 9 ) M ) than the 51 . 5 kDa GHBP we purified and characterised from human plasma ( kDa = 1 . 1 10 10 ( 9 ) M ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Serum concentrations of IGF 1 , IGF binding protein 1 ( IGFBP 1 ) , IGFBP 3 , GH binding protein ( GHBP ) , lipids , and safety laboratory tests ( complete blood count and chemistry profile ) were measured in fasting samples ( 0800 0900 h ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To elucidate the role of GH in fetal development , levels of GH binding protein ( GHBP ) were measured in the serum of nonpregnant and pregnant women and neonates as well as in amniotic fluid obtained at various stages of gestation . ^^^ Total GHBP ( the sum of free GHBP and GHBP bound to GH ) is measured by a ligand mediated immunofunctional assay . ^^^ GHBP appears to be derived from GH receptors of fetal organs ( most probably fetal liver ) . ^^^ The low level of GHBP in fetal serum may be the result of a decrease in GH receptors caused by high levels of circulating GH . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Ames dwarf mice that do not express growth hormone ( GH ) or prolactin ( PRL ) genes were used to study the effects of GH deficiency on the presence and the characteristics of GH binding protein ( GHBP ) in serum . ^^^ Since Ames dwarf mice have no GH in the circulation , all the GHBP is free . ^^^ Moreover , this value ( 0 . 7 nM ) closely resembles the concentration of free GHBP in the serum of transgenic mice overexpressing GH , in which peripheral GH levels are grossly elevated . ^^^ These observations can be interpreted as evidence that the levels of free GHBP in mouse serum are independent of GH concentration , and that GH influences only the levels of bound GHBP in peripheral circulation . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Binding characteristics of the recombinant mGHBP to mouse growth hormone were similar to those for serum GHBP . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To date , measurements of GH binding protein ( GHBP ) during human pregnancy have been carried out using assays susceptible to interference by the elevated levels of human placental GH typical of late gestation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Plasma levels of GH , GHBP , IGF 1 , and IGFBP 3 were determined by RIA . ^^^ After 18 months of GH treatment the significant decrease in GHBP plasma levels observed after 6 months was no longer significant . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The aim of this study was to assess the growth hormone ( GH ) axis in methylphenidate ( MPH ) treated and untreated boys with attention deficit and hyperactivity disorder ( ADHD ) , by evaluating serum GH , GH binding protein ( GHBP ) activity , and insulin like growth factor 1 ( IGF 1 ) levels as compared to age matched normal controls . ^^^ No significant differences were detected between the MPH treated ADHD children , the untreated ADHD children , and the control children on fasting serum GH levels , GHBP activity , or IGF 1 levels . ^^^ Active treatment with MPH , in ADHD children on a drug holiday protocol , does not cause changes in GH axis as manifested by normal values of GH , GHBP , and IGF I . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Spontaneous GH secretion , IGF 1 , free IGF 1 ( fIGF 1 ) , IGF 2 , their binding proteins ( IGFBP 1 , IGFBP 2 , and IGFBP 3 ) , and GH binding protein ( GHBP ) values at the time of clinical diagnosis ( n = 65 ) , after a 25 % decrease in the body mass index ( BMI ) expressed as the SD score ( BMI SD score ; n = 29 ) , and after a diminution of at least 50 % of the initial BMI SD score ( n = 9 ) are reported . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We report their spontaneous GH secretion and IGF 1 , free IGF 1 ( fIGF 1 ) , IGF 2 , the IGF binding proteins ( IGFBP 1 , IGFBP 2 , and IGFBP 3 ) , and GH binding protein ( GHBP ) levels at the time of the clinical diagnosis ( n = 50 ) and after recuperation of between 6 8 % ( n = 42 ) and 10 % or less of the initial weight ( n = 20 ) . ^^^ Independently of GH secretory dynamics , IGF 1 , IGFBP 3 , and GHBP serum levels were all significantly decreased at diagnosis , and only GHBP returned to normal after weight recuperation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The high affinity growth hormone binding protein ( GHBP ) circulates in human blood and represents the extracellular domain of the growth hormone ( GH ) receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In contrast , radioreceptor assays are sensitive to both GH variant mixtures and to the high affinity GHBP . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The aim of this study was to investigate if there was a connection between GH binding protein ( GHBP ) and leptin . ^^^ These included 107 healthy children with normal GH secretion , 55 GH deficient ( GHD ) children and 55 children born small for gestational age ( SGA ) sampled on one occasion for GHBP and leptin , and 12 healthy children followed longitudinally at monthly interval for 1 year . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The level of GH binding protein ( GHBP ; nanomoles per L ) was higher in Turner women [ 1 . 87 + / 0 . 72 ( T ) vs . 1 . 22 + / 0 . 33 ( C ) ; P = 0 . 0005 ] ; after adjustment for FFM , the difference in GHBP levels disappeared between Turner patients and controls . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The specificity of this high affinity GHBP is somatogenic , since bovine GH competes as well as human GH for 125I hGH bound to binding protein , while ovine PRL competes only partially and with low affinity . ^^^ Proteins that bind growth hormone ( GHBP ) have been identified in the blood of many mammalian and avian species , but not in reptilian species . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The knowledge we have today indicates that GH / IGF axis , through a complex system comprising GHR , GHBP , IGFs , IGF receptors and IGFBPs may be responsible for both early and late renal changes in experimental diabetes ( Fig . 3 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Formation of 125I labeled bovine GH binding protein ( GHBP ) complexes with somatogenic characteristics was demonstrated in the serum of both normal and GH transgenic mice . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
These alterations include changes in the levels of 24 hour spontaneous GH secretion , high affinity , low capacity GH binding protein ( GHBP ) , IGF 1 , IGF 2 and the IGF binding proteins ( IGFBPs ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In addition , GHBP plasma levels did not show any significant change during the three years of therapy with GH . ^^^ Growth hormone binding protein ( GHBP ) levels were normal at the time of diagnosis . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
AIMS : To evaluate the developmental pattern of fetal growth hormone ( GH ) , insulin like growth factor 1 ( IGF 1 ) , GH binding protein ( GHBP ) and IGF binding protein 3 ( IGF 3 ) ; to determine the implications for fetal growth . ^^^ METHODS : Serum GH , IGF 1 , GHBP and IGFBP 3 were measured in 53 fetuses , 41 aged 20 26 weeks ( group A ) and 12 aged 31 38 weeks ( group B ) . ^^^ GHBP was determined by gel filtration chromatography of serum incubated overnight with 125I GH . ^^^ Multiple regression analysis showed a negative correlation between GH : IGF 1 ratio and fetal growth indices CONCLUSIONS : The simultaneous evaluation of fetal GH , IGF 1 , IGFBP 3 and GHBP suggests that the GH IGF 1 axis might already be functional in utero . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Girls with Laron syndrome having positive growth hormone binding protein ( GHBP ) are less retarded in height than those lacking GHBP . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Height velocity , serum IGF 1 , IGF binding protein 3 ( IGFBP 3 ) and GH binding protein ( GHBP ) concentrations , and GH responses to GHRP 2 by i . v . bolus and intranasal spray were examined during treatment . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We conclude that ( 1 ) ISS children may have a structural or quantitative defect at the level of the GHR , and ( 2 ) the highly specific assay for E 3 GHBP immunoreactivity provides a sensitive diagnostic tool in conditions with partial GH insensitivity . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We used a rat model to investigate the long term effects of prepubertally started GnRH a treatment ( triptorelin ) on growth , spontaneous GH secretion , hepatic GH receptors ( GHR ) , and GH binding protein ( GHBP ) and compared it with surgical gonadectomy . ^^^ In females , growth was enhanced by triptorelin , baseline GH secretion was decreased , and hepatic GHR and GHBP were decreased . ^^^ GH peak amplitude was the only parameter of GH secretion affected and decreased , whereas GHR or GHBP were not affected . ^^^ We conclude that triptorelin treatment affected growth and the GH GHR GHBP axis in rats , more markedly in females than in males . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Among these , reduced levels of plasma glucose and serum GHBP , a decrease in the ratio of IGF I / IGFBP 1 , accelerated GH pulse frequency , and elevated interpulse GH levels are indicative of a hypometabolic state . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We compared two binding assays for growth hormone binding protein ( GHBP ) measurements , which differ in the method of bound and free GH separation : HPLC gel filtration or dextran coated charcoal adsorption ( DCC ) . ^^^ Analytical performance and clinical usefulness of two binding assays for growth hormone binding protein ( GHBP ) measurement : high performance liquid chromatography ( HPLC ) gel filtration and dextran coated charcoal adsorption . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The role of GH binding protein ( GHBP ) in growth regulation is still under debate . ^^^ We investigated 29 prepubertal healthy children ( 13 girls / 16 boys ; mean age 9 . 3 y to study intraindividual variation in serum GHBP and to explore whether any such variation was related to changes in IGF 1 , IGF binding protein 3 ( IGFBP 3 ) or urinary excretion of GH . ^^^ Thus , the variation in GHBP concentrations appears to mirror GH sensitivity , because no parallel changes in urinary GH excretion were observed . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Spontaneous 12 hour GH and stimulated GH values were significantly higher and GH binding protein ( GHBP ) was significantly lower in the CRF patients than in the normal short children . ^^^ GH therapy induced a smaller increment in GHBP and IGF 1 in the CRF patients versus the normal short children ( 8 . 8 + / 2 . 2 and 10 . 2 + / 2 . 7 5 24 . 8 + / 1 . 3 and 27 . 6 + / 2 . 5 nmol / L , respectively , P < . 01 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The R77C mutant GH possessed a 6 times greater affinity to GHBP than the wild type GH , and inhibited tyrosine phosphorylation in IM 9 cells 10 times more potently than the wild type GH , showing an antagonistic or a dominant negative action . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Baseline blood samples were collected for GHBP , the extracellular portion of the GH tissue receptor ( by ligand mediated immunofunctional assay ) , IGF 1 ( by RIA ) , and IGFBPs 1 5 ( by RIA ) . ^^^ We speculate that in the fitter males , lower GHBP levels may reduce hepatic sensitivity to GH . ^^^ Fitness ( as assessed by muscle mass and peak VO 2 ) does modulate the GH IGF 1 axis , but not solely through circulating IGF 1 ; both GHBP and IGFBPs play important roles . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
HSDS and IGF 1 were significantly lower and GHBP significantly higher in GH deficient patients compared to the group with normal GH secretion at follow up . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Serum levels of IGF 1 , GH binding protein ( GHBP ) , and IGFBP 3 were measured before and 24 hr after a single subcutaneous injection of recombinant human GH ( rhGH , 0 . 14 units / kg ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We , therefore , evaluated interrelationships among serum levels of insulin , IFG 1 , IGF binding protein ( IGFBP ) 1 and 3 and growth hormone binding protein ( GHBP ) in prepubertal obese children . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
All subjects underwent a 24 h GH profile ( 20 minute sampling ) , measurement of serum IGF 1 , IGF 2 , IGFBP 3 , IGFBP 2 and growth hormone binding protein ( GHBP ) and , after an overnight fast , an AST ( intravenous arginine 20 g / m2 over 30 minutes ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In this further study we have evaluated serum growth hormone ( GH ) binding protein ( GHBP ) , IGF 1 and IGFBP 3 in patients with beta thalassaemia major and the effects of GH treatment on these various parameters . ^^^ GH treatment in the 13 patients resulted in significant growth acceleration associated with a significant rise in the serum IGF 1 and IGFBP 3 and a significant fall in serum GHBP concentrations . ^^^ CONCLUSIONS : The low serum concentrations of IGF 1 and IGFBP 3 in the presence of normal GH reserve and serum GHBP concentrations in patients with beta thalassaemia suggest a state of partial GH insensitivity at the post receptor level . ^^^ The lack of correlation of IGF 1 , IGFBP 3 and GHBP with height SDS of the patients imply that the growth failure commonly observed in patients with beta thalassaemia major may not be specifically related to dysregulation of the GH IGF 1 axis . ^^^ GH therapy resulted in significant increase in serum IGF 1 and IGFBP 3 but a significant fall in GHBP . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Before and after the intervention , we measured thigh muscle volume using magnetic resonance imaging and serum levels of mean growth hormone ( GH ) by overnight multiple sampling , GH binding protein ( GHBP ) , IGF 1 , and IGFBPs 1 5 by standard assays . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Height , weight , total body potassium , total body fat , resting energy expenditure , respiratory quotient , hematologic and multiple biochemical profile , number of albumin infusions , insulin like growth factor 1 and 1 , growth hormone binding protein ( GHBP ) , and insulin like growth factor binding protein 1 ( IGFBP 1 ) and insulin like growth factor binding protein ( IGFBP 3 ) were measured at the beginning and end of each treatment period . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have examined the regulation of hepatic growth hormone receptors ( GH R ) and serum GH binding proteins ( GHBP ) in transgenic mice expressing an antagonist of bovine growth hormone ( bGH ) , G119K bGH , and consequently exhibiting a growth suppressed dwarf phenotype . ^^^ The concentrations of free GHBP in normal mice and in transgenic mice expressing wild type GH can be calculated using chromatographic techniques as the dissociation constant ( Kd ) and the ratio of bound 125I GH to free 125I GH in the serum ( [ GHBP ] free = B / F . ^^^ The concentration of IGF 1 , the principal mediator of GH activity , in the G119K bGH transgenic mice was correlated with the concentration of free GHBP . ^^^ This allowed us to use free GHBP concentration as a marker of the effects of the active endogenous hormone ( mGH ) on liver receptors in the presence of different concentrations of the antagonist of GH . ^^^ The levels of GHBP in serum , as well as the concentration of GH R in liver microsomes from mice expressing the bGH antagonist , are up regulated by the high concentration of G119K bGH ( 85 % ) , but significantly less so than that which could be expected for the same concentration of native GH ( 220 275 % ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The objectives were to determine ( 1 ) whether there were any abnormalities in the GH / IGF I / IGFBPs / GH binding protein ( GHBP ) axis , ( 2 ) whether any abnormalities were nutrition dependent , and ( 3 ) whether recombinant human ( rh ) GH could be efficaciously and safely administered . ^^^ MEASUREMENTS : The evaluation included two standard GH provocative tests , GHRH test , night time GH secretion , GHBP ; and IGF 1 , IGFBP 3 and IGFBP 1 before and after 0 . 1 and 0 . 3 U / kg / day of rhGH given i . m . , for 4 days . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Our studies focused on one clone that binds specifically to rat growth hormone binding protein ( GHBP ) yet does not have an ORF . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In conclusion , we found that obese children have elevated GHBP activity , and speculate that this phenomenon may serve to compensate for their reduced GH secretion and accelerated GH clearance . . ^^^ We evaluated growth hormone binding protein ( GHBP ) activity in a group of obese children ( 12 boys and 12 girls , age 3 . 1 14 . 7 years , BMI 21 . 1 33 . 3 , 11 prepubertal and 13 early pubertal ) and in 26 age matched normal weight children ( 14 boys and 12 girls , age 2 . 1 16 . 0 years , BMI 14 . 2 21 . 4 , 18 prepubertal and 8 early pubertal ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We evaluated the circulating levels of GH , insulin like growth factor 1 ( IGF 1 ) , GH binding protein ( GHBP ) , and IGF binding protein 3 ( IGFBP 3 ) before L T 4 therapy in 19 infants with congenital hypothyroidism ( CH ) , aged 12 29 days , diagnosed by neonatal screening and in a group of age and sex matched control infants . ^^^ Serum GHBP was measured by the high performance liquid chromatography gel filtration method ; serum GH , IGF 1 , and IGFBP 3 levels were determined by commercial kits . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To study the acute and long term effect of GH on its down stream axis , we measured serum GH binding protein ( GHBP ) by ligand mediated immunofunctional assay . ^^^ There were small or negligible fluctuations in serum GHBP levels , and no correlation with GH pulses was observed . ^^^ The short term effect of GH on GHBP levels was assessed in eight GH deficient children by daily administration of GH ( 0 . 1 U / kg ) for 10 days . ^^^ We also studied the long term effect of GH administration on GHBP levels in seventeen patients with GH deficiency over six months . ^^^ In conclusion , endogenous pulsatile GH secretion and short term exogenous GH administration had no effect on serum GHBP levels . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) quantitation in biological fluids varies depending on the assays employed , and factors which may interfere in the assays include the high affinity GH binding protein ( GHBP ) . ^^^ To evaluate this potential effect on GH estimates , we studied the influence of adding increasing amounts of high affinity glycosylated GHBP to normal , acromegalic and GH deficient sera , which were then processed in four different immunoassays . ^^^ In the Delfia assays , GH estimates of 11 sera decreased ( p < 0 . 05 ) to 87 . 2 + / 2 . 6 % , 73 . 0 + / 2 . 7 % and 60 . 1 + / 2 . 5 % ( mean + / SEM ) of basal GH estimates with the addition of GHBP in concentrations of 0 . 54 , 2 . 14 and 6 . 42 nmol / l , respectively . ^^^ In the Nichols assay , GH estimates were not significantly reduced ( 93 . 4 + / 2 . 6 % , 83 . 8 + / 4 . 5 % and 83 . 9 + / 3 . 9 % ) with the applied GHBP concentrations . ^^^ In assay 3 ( RIA ) , the addition of GHBP increased GH estimates to 122 + / 10 . 0 % and 167 + / 19 . 1 % ( both p < 0 . 05 ) with the addition of GHBP in concentrations of 2 . 14 and 6 . 42 nmol / l , respectively , whereas an increase in GHBP concentration of 0 . 54 nmol / l did not change the estimates from basal levels ( 99 . 0 + / 4 . 8 % , p > 0 . 05 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The main findings were that patients with LS and normal or high serum GH binding protein ( GHBP ) were less obese than those with a negative GHBP , and that serum leptin levels varied with body mass as in other types of obesity . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Serum concentrations of bioactive GH ( bio GH ) , GH measured by radioimmunoassay ( riGH ) , GH binding protein ( GHBP ) , IGF 1 and IGF binding proteins ( IGFBP ) were determined in 27 premature and term newborns during the first month of life . ^^^ At day 4 , riGH and bio GH concentrations were elevated in both premature and term newborns as compared with normal prepubertal children ; GHBP and IGF 1 levels were low , with a positive correlation with gestational age ( P < 0 . 001 ) . ^^^ During the first month , riGH and bio GH levels decreased in all infants , while IGFI levels increased in premature infants only , and GHBP levels in term infants only . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) resistance is observed with low GH binding protein ( GHBP ) level , and normal or low IGF 1 levels despite elevated GH level . ^^^ Growth hormone ( GH ) resistance is observed with low GH binding protein ( GHBP ) level , and normal or low IGF 1 levels despite elevated GH level . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Serum DHEA , DS , sex steroids , IGF 1 , IGFBP 1 , IGFBP 3 , growth hormone binding protein ( GHBP ) levels and lipid profiles as well as body composition ( by DEXA ) and muscle strength ( by MedX testing ) were measured at baseline and after each treatment . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Insulin secretion in response to an oral glucose tolerance test ( OGTT ) and a GH stimulation test by L dopa , growth hormone binding protein ( GHBP ) and IGF 1 were measured . ^^^ GH AUC to the L dopa stimulation test was negatively correlated with GHBP levels ( r = 0 . 432 . ^^^ In conclusion , we demonstrated that : ( 1 ) visceral fat amount mainly determined GHBP levels in obese men with varying glucose tolerance : ( 2 ) hyperglycemia per se did not influence the GHBP level , whereas insulin and FFA could play a role in regulation of GHBP : and ( 3 ) although GH was not the main regulator of GHBP , the unchanged IGF 1 level despite GH hyposecretion suggests that increased GHBP levels reflect GH hypersensitivity in order to compensate for decreased GH secretion in obesity . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
High affinity growth hormone ( GH ) binding protein ( GHBP ) , body fat mass , and insulin like growth factor binding protein 3 predict the GHBP response to GH therapy in adult GH deficiency syndrome . ^^^ The study objective was to investigate which baseline factors can accurately predict plasma high affinity growth hormone ( GH ) binding protein ( GHBP ) levels after GH replacement therapy in patients with GH deficiency ( GHD ) . ^^^ In contrast to placebo therapy , GH replacement therapy increased the mean plasma levels of IGF 1 and IGFBP 3 to the normal range , whereas a small but statistically significant increase in plasma GHBP was observed . ^^^ These findings indicate that the variations in body fat mass and IGFBP 3 among adult GHD subjects explain the reported variable response of GHBP to GH replacement therapy . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
OBJECT : The high affinity growth hormone binding protein ( GHBP ) represents the extracellular portion of the growth hormone ( GH ) receptor , and its serum levels are a reflection of the tissue receptor status . ^^^ Levels of GHBP are decreased in patients with active acromegaly , probably because of downregulation of GH receptors . ^^^ Although octreotide treatment induced a decrease in the levels of GH , IGF 1 , and IGFBP 3 , as well as an increase in the level of GHBP , these biochemical markers did not reach normal levels . ^^^ On the other hand , after transsphenoidal surgery , GHBP levels became normal , particularly in those patients in whom serum GH could be suppressed to an undetectable level after glucose loading . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
As for the peripheral limb of the GH insulin like growth factor 1 ( IGF 1 ) axis , high free IGF 1 , low IGF binding proteins 1 ( IGFBP 1 ) and 2 ( IGFBP 2 ) , normal or high IGFBP 3 and increased GH binding protein ( GHBP ) circulating levels have been described in obesity . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To investigate the hepatic expression of GH receptor / binding protein ( GHBP ) and IGF 1 genes in chronic renal failure , mRNA levels and the concentrations of its splicing variants were measured by Northern Blot in male 5 / 6 nephrectomized rats ( NX , n = 9 ) , aged 26 + / 1 days , and three groups of sham operated rats : ( 1 ) fed ad libitum ( SAL , n = 9 ) ; ( 2 ) pair fed with NX ( SPF , n = 7 ) ; and ( 3 ) pair fed with NX in terms of protein ingestion but calorically supplemented up to the intake of SAL ( SPF+ , n = 8 ) . ^^^ GH receptor / GHBP gene expression was detected as two bands of 4 . 7 and 1 . 2 kb , respectively . ^^^ These data confirm that expression of liver GH receptor / GHBP and IGF 1 genes is markedly decreased in uremic rats . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Insulin like growth factor 1 ( IGF 1 ) and growth hormone binding protein ( GHBP ) were measured in a group of 19 depressed women and a group of 16 healthy women . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Hepatic resistance to GH is , at least in part , caused by diminished GH receptors as reflected by diminished circulating GHBP levels . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The present study constitutes the characterization of a specific , high affinity GH binding protein ( GHBP ) in the serum of a teleost , the goldfish ( Carassius auratus ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In addition , serum levels of GH , IGF 1 , IGFBP 3 and GHBP were measured before and under treatment and adverse events were assessed in treatment group . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The main confounders in the estimation of GH levels ( now that the use of GH standards other than that recommended by the World Health Organization has largely been eliminated ) are GH heterogeneity , anti GH antiserum binding site specificity and interference from circulating high affinity GH binding protein ( GHBP ) . ^^^ The present study investigates these factors , focussing on the influence of GHBP and antibody binding site specificity on various assays for GH . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To understand the growth mechanism of this boy , we analyzed the serum growth hormone ( GH ) with a radioimmunoassay ( RIA ) , serum GH bioactivity with Nb 2 and erythroid progenitor cell bioassays , and growth hormone binding protein ( GHBP ) with a ligand mediated immunofunctional assay ( LIFA ) . ^^^ Peak GH RIA responses to insulin , arginine and GH releasing factor , and nocturnal GH secretion , were low ( 0 . 5 2 . 3 ng / ml ) ; bioactive GH was low ( 0 . 313 ng / ml ) , and GHBP was elevated ( 84 ng / ml ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Circulating GH binding protein ( GHBP ) levels were significantly reduced ( P < 0 . 05 ) in GH treated ( 299 . 1+ / 51 . 54 ng / ml ) compared with saline treated ( 503 . 9+ / 62 . 43 ng / ml ) ad libitum fed dams , but were not altered in 30 % ad libitum fed dams . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Acute endurance type exercise increased serum GH , GH binding protein ( GHBP ) , total IGF 1 , IGF binding protein ( IGFBP ) 3 , and acid labile subunit ( ALS ) , each peaking at the end of exercise . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To study the effects of homologous mouse GH ( mGH ) on the presence and characteristics of serum GH binding protein ( GHBP ) we have used transgenic mice expressing GH releasing hormone ( GHRH ) as a model . ^^^ This increment closely resembles the increased concentration of GHBP in the serum of transgenic bovine GH ( bGH ) mice , in which peripheral bGH levels are grossly elevated . ^^^ Our results also demonstrate the presence of high molecular weight forms of GH GHBP complexes that could be dissociated by dilution or in the presence of 2 mercapto ethanol . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
METHODS : We compared overnight fasting serum levels of free and total ( extractable ) IGF 1 and 2 , IGF binding protein ( IGFBP ) 1 , 2 and 3 , and the high affinity GH binding protein ( GHBP ) in matched groups of lean subjects ( n=26 ) and obese subjects without ( n=24 ) and with ( n=29 ) Type 2 diabetes . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH binding protein ( GHBP ) levels were increased in the patient group . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH forms a high Mr complex in rat serum distinct from that with GH binding protein ( GHBP ) . ^^^ The distribution of GH binding to GHBP and this high Mr serum factor was investigated by incubating [ 125I ] hGH in sera containing a low ( 5 nM ) and a high ( 35 nM ) concentration of GHBP over a range of physiological GH concentrations . ^^^ In sera containing a low concentration of GHBP , the proportion of GH complexed in peak 1 increased with increasing GH concentrations . ^^^ In sera with a high concentration of GHBP , GH was complexed mainly in peak 2 . ^^^ This factor may provide supplementary capacity for GH binding when binding to GHBP is saturated . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The Ati Negritos showed lower growth hormone binding protein ( GHBP ) , insulin like growth factor 1 ( IGF 1 ) , insulin like growth factor binding protein 3 ( IGFBP 3 ) , acid labile subunit ( ALS ) , zinc , albumin , ferritin , iron , iron saturation and much higher insulin like growth factor binding protein 2 ( IGFBP 2 ) and plasma transferrin concentrations . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The aim of our study was to determine the effects of 36 h fasting on 8 h diurnal GH , insulin and glucose levels as well as on basal IGF 1 , IGFBP 3 , acid labile subunit ( ALS ) , IGFBP 1 , GHBP and free fatty acid ( FFA ) levels . ^^^ STUDY DESIGN : In all subjects we studied the effects of 36 h fasting on 8 h daytime GH , insulin and glucose levels ( assay every 30 min from 0800 h to 1600 h ) as well as on basal IGF 1 , IGFBP 3 , ALS , IGFBP 1 , GHBP and FFA levels . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Serum GH binding protein ( GHBP ) levels tended to be lower after GH and OCT than after GH alone ( P =0 . 10 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone binding proteins ( GHBP ) have been identified in the blood of many species . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
METHODS : GHBP was determined by a time resolved fluoroimmunoassay ( GHBP TR FIA ) based on a commercially available immunoassay for GH , the DELFIA GH assay . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We previously described significant changes in GH binding protein ( GHBP ) in pathological human pregnancy . ^^^ GHBP has the potential to modulate the proportion of free placental GH ( PGH ) and hence the impact on the maternal GH / insulin like growth factor 1 ( IGF 1 ) axis , fetal growth , and maternal glycemic status . ^^^ The results are consistent with an inhibitory function for GHBP in vivo and support a critical role for placental GH and IGF 1 in driving normal fetal growth . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
A significant reduction was found in serum GHBP levels in the patients as compared to the controls ( 28 . 21 + / 1 . 93 and 35 . 83 + / 2 . 90 , respectively , p = . 02 ) , while serum IGF 1 and growth hormone levels were similar in patient and control groups . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The application of growth hormone binding protein ( GHBP ) inhibited the cell growth of Th 1 clones . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Mean overnight GH and fasting GH binding protein ( GHBP ) , IGF 1 , and leptin levels were also measured . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To obtain some initial information about potential endocrine factors , we measured the serum concentrations of GH , IGF 1 , IGFBP 3 and GHBP in healthy young men shorter than 159 cm and taller than 187 cm . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Despite restoration of GHR and GHBP to normal , growth , serum IGF 1 and its liver mRNA were not stimulated by GH infusion in ZD rats , indicating that IGF 1 synthesis requires the presence of zinc in addition to GH , and that the lack of growth promoting action of GH in zinc deprived rats results from a defect beyond GH binding to its liver receptors . . ^^^ Compared with pair fed rats , zinc deficiency produced attenuated weight gain ( 43 % , P < 0 . 001 ) , lower serum IGF 1 and liver IGF 1 mRNA ( 52 % , P < 0 . 001 and 44 % , P < 0 . 05 ) , lower serum IGFBPs ( IGFBP 3 66 % , IGFBP 4 48 % , 34 29 kDa IGFBP cluster 53 % , P < 0 . 05 ) , lower liver GHR and its mRNA ( 20 and 34 % , P < 0 . 05 ) and lower serum growth hormone binding protein ( GHBP ) and its mRNA ( 56 and 48 % , P < 0 . 05 ; all comparisons vs PF rats ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Intersubject responsiveness of high affinity growth hormone ( GH ) binding protein ( GHBP ) to long term GH replacement therapy . ^^^ The aim of this study was to investigate which baseline variables determine the reported variable intersubject responsiveness of high affinity GH binding protein ( GHBP ) to GH replacement therapy . ^^^ In the setting of a double blind study over 12 months with placebo control over the first 6 months , we analyzed the interrelationship between a number of baseline variables , which vary considerably amongst subjects , and the GHBP response to GH replacement in 31 GHD adults ( 21 males and 10 females ) . ^^^ Step wise multiple regression analyses revealed that during the 6 months placebo period baseline GHBP explained 83 % of the variance in post placebo GHBP , whereas the variance in post treatment GHBP could be accurately predicted ( adjusted R2=0 . 93 ) from baseline GHBP and body fat mass , irrespective of the duration of GH treatment . ^^^ These findings indicate that the variable intersubject responsiveness of GHBP to GH replacement therapy is mainly due to differences in baseline body fat mass amongst adult GHD patients , and that in female patients a relatively low baseline IGFBP 3 contributes to a rise in serum GHBP after GH treatment . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Of importance is that GHBPa exhibited significantly higher Mr ( 78 182 K , +DTT ) than that predicted by GHBP cloning , suggesting that they may be covalently bound to other non GH binding proteins or may be distinct entities . ^^^ These novel findings challenge the current view of the mechanism for generation of the rat serum GHBP and raise the intriguing possibility that the two classes of GHBP may play distinct and important roles in GH physiology . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
SUBJECTS AND METHOD : Serum samples from two GH stimulation tests and two 24 h urine samples were sent to a Central Laboratory to measure serum and urinary GH , serum IGF 1 , IGFBP 3 and GHBP , both in absolute and standardized values ( Z score ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Serum IGF 1 , IGF binding protein 3 ( IGFBP 3 ) , GH binding protein ( GHBP ) , insulin and glucose levels were determined at baseline and 12 h after the first and the last rhGH administration . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
MEASUREMENTS AND MAIN RESULTS : Serum concentrations of insulin , insulin growth factor 1 ( IGF 1 ) , insulin growth factor binding proteins 1 and 3 ( IGFBP 1 and IGFBP 3 ) , growth hormone binding protein ( GHBP ) , and urinary concentrations of GH and free cortisol ( UFC ) were measured on days 1 , 2 , and 7 of the study period . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We found a threshold value of body mass index percentile ( by age ) of about 71 , above which systematic changes in GHBP , IGFBP 1 , and peak VO ( 2 ) per kilogram were noted , suggesting decreases in the following : 1 ) GH function , 2 ) insulin sensitivity , and 3 ) fitness . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
STUDY DESIGN : We studied the effects of 36 h fasting on 8 h diurnal mean GH , insulin and glucose concentrations ( mGHc , mINSc and mGLUc ; assay every 30 min from 8 . 00 am to 4 . 00 pm ) as well as on IGF 1 , IGFBP 3 , ALS , IGFBP 1 , GHBP and free fatty acid ( FFA ) levels . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Elevated levels of circulating GH , increased GH secretory amplitude , and decreased concentrations of IGF 1 , IGFBP 3 , and GHBP have been related to poor glycemic control . ^^^ Twenty four hour every 20 minute blood sampling for GH determination was analyzed using the Cluster algorithm , and static measures of IGF 1 , IGFBP 3 , and GHBP were obtained . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The GH binding protein ( GHBP ) corresponds to the extracellular , ligand binding domain of the GH receptors in tissues and its serum concentration may reflect the status of the tissue receptors . ^^^ GHBP has no diagnostic value in acromegaly or GH deficiency . ^^^ However , it may be a potential biochemical marker for GH insensitivity syndrome as serum GHBP concentrations are undetectable or reduced in > 75 % of these patients . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
METHODS : The serum GH , GH binding protein ( GHBP ) , IGF 1 , endotoxin , prealbumin , and liver function of 60 male in patients with OJ were investigated 1 day before operation and 1 , 3 , and 7 days after the operation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To this goal , in 22 patients with burn [ BURN , age ( mean+ / SE ) : 46 . 5+ / 3 . 4 yr , BMI : 25 . 0+ / 0 . 8 kg / m2 , % burn surface area : 26 . 0+ / 3 . 0 % , ROI score : 0 . 22+ / 0 . 1 ] we evaluated IGF 1 , IGF binding protein ( IGFBP 3 ) , GH , GH binding protein ( GHBP ) , pre albumin ( pre A ) , albumin ( A ) and transferrin ( TRA ) levels on days 1 , 3 , 7 , 14 and 28 after intensive care unit ( ICU ) admission . ^^^ IGF 1 , IGFBP 3 , GH and GHBP levels were also assayed basally in 29 normal subjects ( Ns ) ( Ns , age : 47 . 5+ / 2 . 8 yr , BMI : 22 . 0+ / 1 . 4 kg / m2 ) and in 34 panhypopituitary patients with severe GH deficiency ( GHD , age : 42 . 7+ / 2 . 5 yr , BMI : 25 . 6+ / 0 . 8 kg / m2 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
MEASUREMENTS : In addition to the colourimetric ( MTT ) response to hGH , we measured free hGH by stripping out GHBP bound hGH using beads coupled to a monoclonal antibody to the GHBP ( GH binding protein ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Serum IGF 1 and 2 , IGFBP 1 , 2 and 3 , GH and GHBP levels were studied on day 1 , 3 , 5 and 7 after ICU admission , during comparable artificial nutrition in SEP and TRA and basally in AS . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Fasting serum androstenedione , testosterone , 17 hydroxyprogesterone , estrone , estradiol , insulin and IGF 1 concentrations were measured by RIA , GH binding protein ( GHBP ) by IFMA and IGF binding protein ( IGFBP ) 1 and IGFBP 3 by IRMA . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Transgenic pigs expressing bovine , ovine , or human growth hormone ( GH ) structural genes fused to mouse metallothionein 1 ( mMT bGH ) , ovine MT ( oMT oGH ) , or mouse transferrin ( mTf hGH ) promoters were used to study the effects of GH on the regulation of serum GH binding protein ( GHBP ) . ^^^ Thus , to avoid interference of binding by high GH concentrations , serum samples were subjected to immunoblotting using a specific anti GHBP antibody . ^^^ The amount of circulating GHBP remained unchanged even in oMT oGH and mTf hGH pigs that were exposed from birth to circulating concentrations of GH as high as 2 , 750 ng / mL . ^^^ Thus , we conclude that heterologous GH do not act as modulators ofthe serum GHBP in pigs . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Basal serum GH , GH binding protein ( GHBP ) , IGF 1 , IGF binding protein 3 ( IGFBP 3 ) levels were determined as well as GH levels during GHRH stimulation . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Finally , we also found that GHBP was inversely correlated with fitness , suggesting altered GH function in more sedentary boys . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Impact of GHBP interference on estimates of GH and GH pharmacokinetics . ^^^ OBJECTIVE : Circulating GH binding protein ( GHBP ) may interfere with GH measurements in immunoassays by competing with the antibodies for ligands . ^^^ SUBJECTS AND METHODS : To assess the influence of GHBP in a widely used commercial immunometric GH kit ( DELFIA , Wallac , Finland ) we systematically tested the effects of varying GHBP concentrations and assay incubation times on GH estimates over a broad range of GH concentrations . ^^^ RESULTS : GHBP at physiological concentrations of 0 . 2 , 0 . 5 , 1 . 0 , 2 . 0 nm reduced the GH estimates by as much as 40 % at low GH concentrations . ^^^ The increase in measured GH using 24 h vs . 2 h incubation showed a strong positive correlation to the subjects ' GHBP levels ( r = 0 . 66 , P < 0 . 001 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GHBP plasma levels , which reflect the number of GH receptors at the level of the liver , do not decline in our malnutrition free elderly population , and thus are not involved in the decline of IGF 1 plasma levels with age . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Overnight fasting levels of free and total IGF 1 , total IGF 2 , GH binding protein ( GHBP ) and IGF binding proteins ( IGFBP ) 1 , 2 and 3 were measured by RIA at baseline and after 6 and 12 months GH treatment . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
OBJECTIVE : Oral but not transdermal oestrogen administration reduces IGF 1 , and increases GH binding protein ( GHBP ) reflecting effects on hepatic endocrine function in postmenopausal women . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
It remains to be elucidated whether insulin like growth factors ( IGFs ) , IGF binding proteins ( IGFBPs ) , IGFBP 3 protease , and GH binding protein ( GHBP ) are abnormal in HIV lipodystrophy . ^^^ GHBP was increased , whereas GH was decreased in LIPO ( all P < . 05 ) . ^^^ GH correlated inversely with GHBP in pooled groups ( P < . 05 ) . ^^^ Taken together the similar IGFs and IGFBP 3 concentrations between study groups , including suppressed GH , and increased GHBP in LIPO , argue against GH resistance of GH sensitive tissues in LIPO compared with NONLIPO ; however , this notion awaits examination in dose response studies . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Serum PGH was determined in a solid phase immunoradiometric assay , serum GH and insulin in a time resolved immunofluorometric assay , and serum GHBP in an in house immunofunctional assay . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Their common binding protein , GH binding protein ( GHBP ) , displays peak serum levels at mid gestation in normal individuals . ^^^ In the non pregnant state , diabetes is known to be associated with elevated levels of GH and decreased levels of insulin like growth factors ( IGFs ) and GHBP . ^^^ In 51 type 1 diabetic women , blood samples were collected in gestational week 10+ , 16+ , 22+ , 28+ and 34+ , and analysed for their serum content of GHBP , PGH , and GH . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
OBJECTIVE : The objective of this study was to define the optimal time point of postoperative evaluation by serial measurements of glucose suppressed GH levels [ oral glucose tolerance test ( OGTT ) ] and the GH dependent parameters IGF 1 , free IGF 1 , acid labile subunit ( ALS ) , and GH binding protein ( GHBP ) . ^^^ MAIN OUTCOME MEASURES : The main outcome measures were OGTT results at 1 , 2 , 3 , 8 , and 12 wk after TA ; weekly measured GH , ( free ) IGF 1 , ALS , and GHBP levels up to 12 wk ; and total IGF 1 levels measured at 52 wk . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Serum Growth hormone binding protein ( GHBP ) , insulin growth factor 1 ( IGF 1 ) and IGF binding protein ( IGFBP ) 3 levels are all significantly decreased in patients with AN and return to normal with refeeding . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH binding protein ( GHBP ) and body mass index ( BMI ) influence GH kinetics , but their impact on PGH kinetics is unknown . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Patients were evaluated by the determination of baseline ( fasting ) IGF 1 , ALS and GHBP and of glucose and GH during OGTT . ^^^ The aim of our study was to evaluate the role of acid labile subunit ( ALS ) , a component of the 150 kD IGF I / IGFBP 3 / ALS complex , and the growth hormone binding protein ( GHBP ) in the follow up of patients with acromegaly after therapeutic intervention . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Maternal and mixed umbilical cord blood was collected at delivery and analyzed for insulin , glucose , IGF 1 , IGF 2 , IGFBP 1 , IGFBP 3 , GH , and GHBP . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The beta chain of the interleukin 2 ( IL 2 ) receptor ( IL 2R beta ) and the interleukin 3 ( IL 3 ) binding protein AIC2A are members of the family of cytokine receptors , which also includes the receptors for growth hormone ( GHR ) and prolactin . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Central GH receptors ( GHR ) have been identified in hypothalamic and extra hypothalamic tissues of rabbit and chicken brains . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH ( GHR ) and lactogenic receptors were analyzed after use of the cross linking reagent ethylene glycol bis ( succinimidyl succinate ) to attach covalently iodinated human GH ( hGH ) to binding proteins 1 ) on intact IM 9 lymphocytes , 2 ) in a partially purified GHR preparation from rabbit liver , and 3 ) in crude microsomal fractions from rabbit liver , rabbit mammary gland , and rat liver . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We measured the ratio of GH by radioreceptor assay ( RRA ) using IM 9 cells to its radioimmunoassay ( RIA ) level in : ( a ) 25 children and young adults with normal growth ( controls ) ; ( b ) 7 poorly growing children with GH neurosecretory dysfunction ( GHND ) who had normal stimulated GH but subnormal integrated concentration of GH ( IC GH ) who responded to GH therapy ; ( c ) 4 poorly growing children who had both normal stimulated GH and IC GH but did not respond to GH therapy ( GHNR GH responder ) , and ( d ) 7 poorly growing patients with normal stimulated , and IC GH who responded to GH therapy ( GHR GH responder ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have developed a method using flow cytometry to identify fluorescein conjugated GH receptors ( GHR ) on IM 9 lymphocytes and circulating peripheral blood mononuclear cell subsets . ^^^ Using two color flow cytometry , we identified GHR on circulating B lymphocytes in subjects with GH deficiency ( n = 9 ) , precocious puberty ( n = 6 ) , and Turner syndrome ( n = 5 ) and in seven subjects with miscellaneous disorders , including familial short stature , bone dysplasia , Crohn disease , congenital adrenal hyperplasia , and acromegaly . ^^^ The percentage of B lymphocytes expressing GHR in subjects with GH deficiency ( mean + / SD , 95 + / 9 % ) , precocious puberty ( 91 + / 15 % ) , and Turner syndrome ( 84 + / 15 % ) was not different from that in normal volunteers ( 90 + / 12 % ; n = 14 ) . ^^^ In 10 subjects , serum GH binding protein levels were assayed simultaneously with B lymphocyte GHR . ^^^ There was a good correlation between GHR expression on B lymphocytes and GH binding protein levels ( r = 0 . 75 ; P = 0 . 01 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To assess the in vitro bioactivity of these hGH fragments we tested their activity against GH responsive FDC P 1 cell lines expressing full length human ( h ) , mouse ( m ) , or rabbit ( r ) GH receptors ( GHR ) . ^^^ Binding competition curves were consistent , with 44 191 having at least a 10 fold lower affinity for rabbit liver GHR and rabbit adipose GHR than bovine GH and a 61 fold lower affinity for hGHBP than hGH . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The binding of growth hormone ( GH ) to its receptor ( GHR ) activates JAK 2 and STATs as well as ERK / MAP kinases . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have analyzed the expression of GH receptors ( GHR ) in murine lymphoid organs using flow cytofluorometry with biotinylated bovine GH and specific fluorescein isothiocyanate labeled monoclonal antibodies defining distinct lymphoid cell populations . ^^^ Our study provides a molecular basis to study the factors controlling GHR expression and to better understand the influence of GH in the regulation of immune function . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The presence of growth hormone receptors ( GHR ) on sheep peripheral blood mononuclear ( PBMN ) cells was studied in two ways . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Although GHRs have also been identified in extrahepatic tissues that produce IGF 1 , the possibility that IGF 1 and insulin might partake in GHR regulation , thereby modulating the effects of GH locally has not received detailed study . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Although the ability of growth hormone ( GH ) to stimulate body growth and regulate metabolism has been recognized for many years , only recently has insight been gained into the molecular mechanisms by which binding of GH to its receptor ( GHR ) elicits its diverse effects . ^^^ The model presented is one in which GH binding to two GHRs causes dimerization of GHR , activation of the GHR associated JAK 2 tyrosine kinase , and tyrosyl phosphorylation of both JAK 2 and GHR . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The presence of growth hormone ( GH ) receptor ( GHR ) gene transcripts and GH binding sites in guinea pig liver suggests normal expression and translation of a GHR gene in these animals . ^^^ Guinea pigs are , however , resistant to GH action and appear to lack the circulating GH binding proteins ( GHBPs ) that result from alternate splicing of the GHR message or from cleavage of the extracellular binding domain of membrane GHRs . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
One contained a 33 bp repeat unit ( 5 ' CCCAAGGTCCCCAAGGTCAGGGAGGCGAAGGCT 3 ' ) located in the 3 ' untranslated region of a putative growth hormone ( GH ) gene , and the repeat was designated as GHR . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
An anti GH receptor ( GHR ) antibody ( MAb 263 ) , which dimerizes the receptor and induces GH like biological actions , significantly stimulated fatty acid oxidation . ^^^ Another anti GHR antibody ( MAb 5 ) , which prevents receptor dimerization , suppressed GH action . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We have previously described two families ( H and M ) with GH binding protein positive Laron Syndrome ( LS ) , proposed to have one or more post GHR signaling defects . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To identify mechanisms by which GH receptors ( GHR ) mediate downstream events representative of growth and metabolic responses to GH , stimulation by GH of c fos and egr 1 expression and glucose transport activity were examined in Chinese hamster ovary ( CHO ) cells expressing mutated GHR . ^^^ In CHO cells expressing wild type GHR ( GHR ( 1 638 ) ) , GH stimulated the expression of c fos and egr 1 , and stimulated 2 deoxyglucose uptake , responses also mediated by endogenous GHR in 3T3 F442A cells . ^^^ Deletion of the proline rich box 1 of GHR ( GHR ( deltaP ) ) abrogated all of these responses to GH , indicating that box 1 , a site of association of GHR with the tyrosine kinase JAK 2 , is crucial for these GH stimulated responses . ^^^ As the C terminal half of the cytoplasmic domain of GHR is required for GH stimulated calcium flux and for stimulation of spi 2 . 1 transcription , GHR lacking this sequence ( GHR ( 1 454 ) ) were examined . ^^^ Not only did GHR ( 1 454 ) mediate stimulation of c fos and egr 1 expression and 2 deoxyglucose uptake , but they also mediated GH stimulated transcriptional activation via Elk 1 , a transcription factor associated with the c fos Serum Response Element . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Expression of EGFR and its mutants into CHO GH receptor ( GHR ) cells revealed that GH induced full activation of MAP kinase and c fos expression required tyrosine phosphorylation sites of EGFR but not its intrinsic tyrosine kinase activity . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Binding of cPL to the extracellular domain ( ECD ) of prolactin receptors ( PRLR ) from rat ( r ) , rabbit ( rb ) , and bovine ( b ) , growth hormone receptors ( GHR ) from human ( h ) and rabbit , and binding to rabbit mammary gland membranes revealed similar binding profiles for cPL Q , cPL S and ovine ( o ) PL . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The effects of porcine GH ( pGH ) and IGF 1 as well as the expression of GH ( GHR ) and IGF 1 ( IGF IR ) receptors mRNA were examined . ^^^ The similar action of pGH and IGF 1 on preadipocyte proliferation and differentiation , associated with the similar expression of GHR and IGF IR mRNA in LW and MS pigs , suggests that the GH / IGF 1 axis is not impaired in MS pigs . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptors ( GHR ) remained occupied for a longer period after MAb GH injection ( 36 + / 16 and 35 + / 8 % at 6 and 12 h , respectively ) compared with bGH alone ( 0 + / 28 and 15 + / 11 % ) , whereas total liver GH binding sites and GHR mRNA levels were not affected by the MAb . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We conclude that although OA 15 does not disrupt GH GH receptor ( GHR ) interactions it does interfere with subsequent GH activity at the molecular and cellular level . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Disulfide linkage of growth hormone ( GH ) receptors ( GHR ) reflects GH induced GHR dimerization . ^^^ The growth hormone ( GH ) receptor ( GHR ) binds GH in its extracellular domain and transduces activating signals via its cytoplasmic domain . ^^^ Both GH induced GHR dimerization and JAK 2 tyrosine kinase activation are critical in initiation of GH signaling . ^^^ In this study , three GH induced phenomena ( GHR dimerization , GHR disulfide linkage , and enhanced GHR JAK 2 association ) were examined biochemically and immunologically . ^^^ By using the GH antagonist , G120K , and an antibody recognizing a dimerization sensitive GHR epitope , we demonstrated that GH induced GHR disulfide linkage reflects GH induced GHR dimerization . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
It has recently been shown that 20 kDa human growth hormone ( hGH ) forms the 1 : 2 hGH : hGH receptor ( hGHR ) complex and expresses full agonistic activity , although it hardly forms the 1 : 1 GH : GHR complex as compared with 22 kDa hGH . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The ontogeny of hepatic growth hormone ( GH ) receptors ( GHR ) , as measured by responses of both plasma insulin like growth factor 1 ( IGF 1 ) and hepatic GHR to an exogenous bGH stimulus , was examined using sheep of different ages ( Days 1 7 , 14 21 , 28 35 , and 56 63 of life , and yearlings ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We therefore determined the expression of growth hormone ( GH ) receptor ( GHR ) , and insulin like growth factors 1 and 2 ( IGF 1 and IGF 2 ) mRNA in liver and skeletal muscle ( longissimus ) of neonatal pigs given daily intramuscular injections of either recombinant porcine GH ( 1 mg / kg body wt ; n = 6 ) or saline ( n = 5 ) for 7 days . ^^^ In liver , GH treatment increased GHR ( 6 . 0 vs . 9 . 7 ; P < 0 . 01 ) and IGF 1 ( 5 . 2 vs . 49 . 0 ; P < 0 . 001 ) but not IGF 2 ( 19 . 5 vs . 17 . 2 ) mRNA . ^^^ In muscle , GH treatment increased IGF 1 mRNA ( 13 . 3 vs . 22 . 8 ; P < 0 . 05 ) but not GHR ( 8 . 3 vs . 9 . 5 ) or IGF 2 ( 16 . 1 vs . 16 . 9 ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
However , GH was unable to cause transactivation of reporter gene constructs harboring Stat 5 binding sites ( the GHREII from the rat spi 2 . 1 gene promoter , and the LHRE from the rat beta casein gene promoter ) , except in cells transiently transfected with either Stat 5 cDNAs or the rat GHR cDNA . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Furthermore , the presence of mRNAs of IGF 2 and of receptors for IGF 1 ( IGF IR ) , growth hormone ( GHR ) and insulin ( IR ) , as well as mRNAs of IGF binding proteins ( IGFBP 1 , 2 and 3 ) were assessed by RT PCR . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Bone remodelling necessary for orthodontic tooth movement involves clastic cells , which are tartrate resistant acid phosphatase ( TRAP ) positive and which may also be regulated by growth hormone ( GH ) via its receptor ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The roles of GH and its receptor ( GHR ) in metabolic control are not yet fully understood . ^^^ We studied the roles of GH and the GHR using the GHR antagonist pegvisomant for metabolic control of healthy nonobese men in fasting and nonfasting conditions . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In conclusion , ( 1 ) n octanoylation of Ghrs and the shorter form hGhr 18 is essential for the direct pituitary GH releasing effect of this new family of endogenous GHSs ; ( 2 ) only the longer forms are active in vivo and ( 3 ) inhibition of SRIH release appears involved in the mechanism of Ghr action . . ^^^ Ghrelin ( Ghr ) , a 28 amino acid gastric peptide with an n octanoylation on Ser 3 , has recently been identified as an endogenous ligand of the growth hormone secretagogue ( GHS ) receptor . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Functional integrity of GHR was suggested by GH induced activation of the cognate JAK2 / STAT5 , MAPK , and Akt intracellular pathways in the cells expressing GHR . ^^^ Thus , in isolated rat neonatal cardiomyocytes expressing GHR , GH induces hypertrophy and causes alterations in cellular metabolic profile in the absence of demonstrable changes in IGF 1 mRNA , suggesting that these effects may be independent of IGF 1 . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The role of GH and its receptor ( GHR ) during prenatal development , however , is still controversial . ^^^ These results suggest that a functional GHR able to modulate carbohydrate and lipid metabolism is synthesized during preimplantation development of the bovine embryo and that this GHR may be subject to activation by embryonic GH after Day 8 . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
However , a high patient percentage reported side effects on high dose GHR resulting in a high rate of patient withdrawal from growth hormone ( GH ) treatment . ^^^ Weight based high dose growth hormone replacement ( GHR ) results in improvements in body composition and QoL in AGHD . ^^^ The aim of this study was to assess the effects of low dose growth hormone replacement ( GHR ) on body composition and QoL as early as 1 and 3 months . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) exerts its multiple actions by binding to a specific receptor ( GHR ) widely distributed in the organism . ^^^ These results provide direct morphological evidence that GHR is localized in the thyroid gland of mammals and opens up the possibility that GH regulates thyroid cell function directly or via local autocrine or paracrine production of insulin like growth factor I . . ^^^ Growth hormone ( GH ) exerts its multiple actions by binding to a specific receptor ( GHR ) widely distributed in the organism . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
By quantitative immunoelectron microscopy , we found that the lysosomal targeted receptors for growth hormone ( GHR ) and epidermal growth factor are concentrated in the coated membrane areas , whereas the recycling transferrin receptor is not . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone replacement ( GHR ) results in improvement of surrogate markers of cardiovascular function . ^^^ Data on effects of GHR on blood pressure ( BP ) in adult growth hormone deficiency ( AGHD ) , however , remain contradictory . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The expression of IGF 1 , GHR , SOCS 3 and beta actin mRNA in the liver was detected by RT PCR and the GH levels were measured by radioimmunoassay , the levels of TNF alpha and IL 6 were detected by ELISA . ^^^ CONCLUSION : The growth hormone insensitivity could be induced by LPS injection , which was associated with down regulated GHR mRNA expression at receptor level and with up regulated SOCS 3 mRNA expression at post receptor level . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
After receptor binding , growth hormone ( GH ) induces GH receptors ( GHR ) dimerization and JAK 2 is activated after its association with a dimerized GHR , stimulating the tyrosyl phosphorylation of insulin receptor substrate 1 ( IRS 1 ) , IRS 2 and Shc proteins . ^^^ G120K PEG , a GH antagonist is produced by a mutation that blocks GH action by preventing the GHR dimerization . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Pituitary growth hormone ( GH ) is essential for postnatal growth in animal , it regulates numerous cellular functions by direct effect on it ' s receptor ( GHr ) in many different tissues . ^^^ And it is believed that the abundance of GHr in different tissue determines the tissue sensitivity to GH . ^^^ The results suggest that , ( 1 ) GHr mRNA in porcine stomach is expressed according a strain specific development pattern ; ( 2 ) GH directly acts at the gastric tissue and regulates it ' s growth . ^^^ Pituitary growth hormone ( GH ) is essential for postnatal growth in animal , it regulates numerous cellular functions by direct effect on it ' s receptor ( GHr ) in many different tissues . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The interaction of GH with GH receptors ( GHR ) on target cells promotes the association of the cellular tyrosine kinase JAK 2 with the GHR , initiating tyrosine phosphorylation of GHR and JAK 2 , and activation of multiple signaling cascades . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Recently , ghrelin ( Ghr ) , a new peptide which specifically stimulates growth hormone ( GH ) release from the pituitary , was identified in the rat and human stomach . ^^^ The present study describes the in vitro effect of rat Ghr on the release of GH and two forms of prolactin ( PRL ( 177 ) and PRL ( 188 ) ) in the tilapia , Oreochromis mossambicus . ^^^ Rat Ghr stimulated the release of GH in a dose related manner after 8 and 24 hr of incubation . ^^^ Rat Ghr had no effect on the pituitary content of GH or PRL ( 188 ) , but significantly increased PRL ( 177 ) content . ^^^ These results show for the first time that rat Ghr significantly stimulates GH and PRL release in teleosts , and suggest that Ghr and a GHS receptor are present in fish . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The present study is an investigation of the presence and characteristics of testicular growth hormone receptors ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Taken together , our findings suggest that differences in GH binding protein concentrations , which possibly reflect GHR expression , determine GH pharmacokinetics rather than age or body composition per se . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In this study , we concurrently examined the effects of 8 and 40 weeks of growth hormone replacement ( GHR ) on lipids , lipoprotein composition , low density lipoprotein ( LDL ) size , very low density lipoprotein ( VLDL ) apolipoprotein ( apo ) B kinetics and LDL apoB kinetics . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Serum T3 / T4 , GH and IGF 1 were measured by RIA , serum IGFBPs were measured by Western ligand blot , liver GHR and IGF I / IGFBPs mRNA were analyzed by radio receptor assay and RT PCR respectively . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone replacement ( GHR ) results in a decrease in leptin concentration and increase in leptin pulsatility , followed by reduction in body fat mass ( BFM ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Liver expression of IGF 1 , GHR and SOCS 3 mRNA was detected by RT PCR , the levels of growth hormone ( GH ) were measured by radioimmunoassay , and the levels of TNF alpha and IL 6 were detected by ELISA . ^^^ RESULTS : Serum GH levels showed no significant change after endotoxin injection ; however , liver IGF 1 and GHR mRNA expressions were obviously down regulated in endotoxemic rats , with the lowest decrease of 53 % and 89 % respectively . ^^^ CONCLUSION : The growth hormone insensitivity could be induced by LPS injection , which might be associated with down regulated GHR mRNA expression and up regulated SOCS 3 mRNA expression . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We investigated the effects of GH replacement ( GHR ) on PTH circulating activity and its association with phosphocalcium metabolism and bone turnover in 16 ( 8 men and 8 women ) AGHD patients . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Important options are UPD 7 and the FGFR 3 , SHOX , GH 1 and GHR genes . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Markers of alleles for three physiological candidate genes for reproductive traits , growth hormone ( GHR ) , gonadotropin releasing hormone receptor ( GNRHR ) and neuropeptide Y ( NPY ) were assessed for the association with the total egg production , number of double yolked eggs and age at first egg in a single generation of a broiler breeder ( Gallus gallus ) pedigree dam line . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH has diverse biological actions that are mediated by binding to a specific , high affinity cell surface receptor ( GHR ) . ^^^ Expression of GHR is tissue specific and a requirement for cellular responsiveness to GH . ^^^ IGF 1 is produced in multiple tissues and regulated in part by GH through GHR . ^^^ In this study , we evaluated GHR and IGF 1 mRNA expression in pituitary gland and compared the levels with those derived from liver of bovine GH transgenic , GH antagonist transgenic , lit / lit mice , and their respective controls using real time RT PCR . ^^^ In liver , both GHR and IGF 1 mRNA expressions were regulated in parallel with GH action in all three animal models , and there was a strong correlation between GHR and IGF 1 mRNA levels . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
To develop a cell free system that can be used to measure cytokine bioactivity we have designed a soluble hybrid molecule consisting of the extracellular domain of the GH receptor ( GHR ) and the intracellular domain of the epidermal growth factor receptor ( EGFR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
BACKGROUND : Adult GH deficiency ( AGHD ) is associated with osteoporosis and reduced bone turnover ; factors improved by GH replacement ( GHR ) , with men gaining greater benefit than women . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Pegvisomant is a GH analogue that includes a single amino acid substitution at position 120 that generates the GHR antagonist . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We investigated the endogenous parathyroid hormone [ PTH ( 1 84 ) ] response to hypocalcemic and hypercalcemic stimuli induced by sodium EDTA and calcium gluconate infusion , respectively , and to PTH ( 1 34 ) infusion in AGHD patients before and during GH replacement ( GHR ) . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Two truncated isoforms of growth hormone ( GH ) receptor ( GHR ) were identified in mice and in humans . ^^^ The proteins encoded by these isoforms lack most of the intracellular domain of the GHR and inhibit GH action in a dominant negative fashion . ^^^ We have quantified the mRNAs encoding the GHR isoforms in mouse tissues by use of real time RT PCR and examined the effect of GH excess or deficiency on regulation of mRNA levels of the GHR isoforms in vivo . ^^^ The ratio of GHR tr to GHR fl mRNA was tissue specific and not affected by chronic excess or deficiency of GH . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
In this study , we investigated the role of human growth hormone ( GH ) and its receptor ( GHR ) in human prostate cancer . ^^^ The LNCaP cell GHR protein was further characterized , on the basis of its M ( r ) of 120kDa , its binding to two different GHR monoclonal antibodies , its high affinity and purely somatogenic binding to ( 125 ) 1 hGH and its ability to secrete GH binding protein , all characteristic of a functional GHR . ^^^ Furthermore , GH induced rapid , time and dose dependent signaling events in LNCaP cells , including phosphorylation of JAK 2 tyrosine kinase , of GHR itself and of STAT5A ( JAK 2 STAT5A pathway ) , of p42 / p44 MAPK and of Akt / PKB . ^^^ In conclusion , the GH induced activation of signaling pathways , its effects on AR protein in LNCaP cells and the isoform specific regulation of GHR in prostate cancer patient tissues , suggest that GH , most likely in concert with other hormones and growth factors , may play an important role in progression of human prostate cancer . . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH binding to a receptor ( GHR ) dimer triggers signaling and internalization of the receptor / ligand complex . ^^^ Pegvisomant is a specific GH antagonist developed for the treatment of acromegaly , and the basic molecule is GH with an amino acid substitution that blocks the conformational change necessary to generate functional GHR dimerization required for signal transduction . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We found statistical evidence that C / EBP , MSRA , SHC 1 , growth hormone , GHR , PIT 1 , and PolgA may influence aging in mice . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Insulin like growth factors 1 and 2 , IGFBP 2 and 3 , and receptors for IGF type 1 and type 2 ( IGF 1R , IGF 2R ) , growth hormone ( GHR ) , and insulin ( InsR ) in neonatal calves are variably expressed among gastrointestinal sites and thought to exert site specific physiological functions . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) , insulin like growth factors 1 and 2 ( IGF 1 and IGF 2 ) and their associated binding proteins and transmembrane receptors ( GHR , IGF1R and IGF2R ) play an important role in the physiology of mammalian growth . ^^^ Growth hormone ( GH ) , insulin like growth factors 1 and 2 ( IGF 1 and IGF 2 ) and their associated binding proteins and transmembrane receptors ( GHR , IGF1R and IGF2R ) play an important role in the physiology of mammalian growth . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The present study therefore examined the influence of maternal nutrient restriction ( NR ) , targeted at specific periods of kidney development during early to mid gestation , on the mRNA abundance of receptors for glucocorticoid ( GCR ) , growth hormone ( GHR ) and insulin like growth factors 1 ( IGF IR ) and 2 ( IGF IIR ) , and the IGF 1 and 2 ligands . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Although absence of the first disulfide bridge has been shown to affect the bioactivity of GH in transgenic mice , little is known of the importance of this bridge in mediating the GH / GH receptor ( GHR ) interaction in humans . ^^^ To study the impact of this mutation in vitro , GHR binding and Janus kinase ( Jak ) 2 / signal transducer and activator of transcription ( Stat ) 5 activation experiments were performed , in which it was observed that at physiological concentrations ( 3 50 ng / ml ) both GHR binding and Jak2 / Stat5 signaling pathway activation were significantly reduced in the mutant GH C53S , compared with wild type ( wt ) GH . ^^^ These results demonstrate that the absence of the disulfide bridge Cys 53 to Cys 165 affects the binding affinity of GH for the GHR and subsequently the potency of GH to activate the Jak2 / Stat5 signaling pathway . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH replacement ( GHR ) results in increased bone mineral density , but its benefit in AGHD patients over 60 yr old has been debated . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Previous studies in our laboratory have shown that GH induction of signal transducers and activators of transcription ( STAT ) 5B tyrosine phosphorylation is inhibited by prolonged insulin treatment , probably via downregulation of GHR . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Growth hormone ( GH ) exerts its effects on growth and metabolism by interacting with a specific receptor ( GHR ) on the surface of the target cells . ^^^ Growth hormone ( GH ) exerts its effects on growth and metabolism by interacting with a specific receptor ( GHR ) on the surface of the target cells . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
HepG 2 cells were transiently transfected with expression vectors containing Oatp1b2 or OATP1B3 promoter fragments , cDNAs for Stat5a , and the receptors for PRL ( PRLR ( L ) ) or GH ( GHR ) , and treated with PRL or GH . ^^^ PRL and GH induction of Oatp1b2 and OATP1B3 promoter activity required cotransfection of Stat5a and PRLR ( L ) or GHR . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Emphasis can be made on the advances of molecular genetics , which have characterized human genes involved in the hypothalamus pituitary GH axis such as GH , POU1F1 , PROP 1 , GHRHR , GHR , IGF , IGFR , HESX 1 , LHX 3 , LHX 4 , among others . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
GH receptors ( GHR ) were observed in the BMEC on the membrane as well as in the cytoplasm . ^^^ Expression of GHR mRNA was increased by DIP treatment , while the mRNA expression was little changed by GH treatment . ^^^ GHR may be involved in a synergic effect between GH and DIP on casein secretion . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
The possibility that pituitary and / or pulmonary GH have physiological roles in lung development has therefore been investigated in GHR knockout ( KO or / ) mice , using a proteomics approach to determine if an absence of GH signaling affects the proteome of the developing lung . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Two genomic contigs of putative growth hormone receptors ( GHRs ) were identified in fugu and zebrafish genomes by in silico analysis , suggesting the presence of two GHR subtypes in a single teleost species . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
Mice with a deficiency in GH function due to disruption of the GH receptor / binding protein gene ( GHR ( / ) ) are long lived , insulin sensitive , and obese , whereas mice with excess GH function due to expression of a bovine GH transgene ( bGH ) are short lived , glucose intolerant , and lean . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
We hypothesized that differences in expression of GH receptors GHR and PRL receptors PRLR during adipocyte development might explain some of the differential effects of the somatogens and lactogens on fat metabolism . ^^^ To that end , we compared : ( a ) the expression of GHR and PRLR mRNAs in 3T3 L 1 preadipocytes during the course of adipocyte differentiation ; ( b ) the induction of STAT 5 activity by GH and PRL during adipogenesis ; and ( c ) the acute effects of GH and PRL on the suppressors of cytokine signaling ( SOCS 1 3 and cytokine inducible SH 2 domain containing protein CIS ) and IGF 1 . ^^^ |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: P10912 and P01241 |
Pubmed |
SVM Score :0.0 |
NA |
|